ID: 1041496512

View in Genome Browser
Species Human (GRCh38)
Location 8:58491528-58491550
Sequence TGCCCAAGCCTGCCCGGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041496512 Original CRISPR TGCCCAAGCCTGCCCGGGAC TGG Exonic
900301076 1:1977647-1977669 TGCCCAGGCCAGCCTCGGACAGG - Intronic
900606598 1:3526325-3526347 TGCCCATGTCTGCCCTGGCCTGG - Intronic
900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG + Intronic
900947461 1:5839125-5839147 TGCCCAATCCTGCCTGGAACTGG - Intergenic
901313986 1:8293026-8293048 TGTCCAACCCTGCCTGGGACTGG + Intergenic
902715592 1:18270449-18270471 TGCCCGAGGCTGCCCTGGAGAGG - Intronic
902737165 1:18408843-18408865 TGCCCTCGCCTGCCCTGGAGTGG - Intergenic
903948215 1:26977695-26977717 TGCATAGGCCTGCCCAGGACAGG + Intergenic
904025307 1:27499111-27499133 TGCACAAGCCTGGCCAGGGCAGG - Intergenic
906165258 1:43681324-43681346 TGACTAAGCCTTCCAGGGACAGG - Intronic
908742369 1:67342036-67342058 TTCCCAAGCCTGCCTGAGAGTGG - Intronic
912384244 1:109263430-109263452 TGCCCAGGCCTGCCTCTGACTGG - Intronic
912495074 1:110086280-110086302 TGTCCCAGCCTGCCAGGCACGGG + Intergenic
915168771 1:153963434-153963456 TGCCCAGGCCTCCCCGGGCCCGG - Exonic
919455376 1:197814757-197814779 GGCCAAAGCCTGTCCCGGACTGG + Intergenic
919653994 1:200180162-200180184 TGCCCAAGCCCACCGAGGACAGG - Intergenic
921930146 1:220748321-220748343 TGACCAAGCCTGCGCGGTAATGG - Exonic
922797963 1:228350948-228350970 GGCCCAGGCCTGCCCGGGGATGG + Intronic
922881953 1:228987828-228987850 TGCTCAAGACTGCCCTGGAAAGG - Intergenic
923561923 1:235048060-235048082 AGTCCAAGCCTGCCAGGGTCTGG + Intergenic
1063374489 10:5545943-5545965 GGCCCAAGCCACCCAGGGACTGG - Intergenic
1067282858 10:44886030-44886052 CCCCCAAGCCTGGCAGGGACAGG + Intergenic
1069994113 10:72332238-72332260 TGCCCAGGCCTCCCAGAGACAGG - Intergenic
1070319329 10:75343083-75343105 TTCCCAAGCCTCCCCTGGACAGG + Intergenic
1070593877 10:77819261-77819283 TGCCCAAGCCTGCCTGGACATGG - Intronic
1070606513 10:77902115-77902137 TGTCCAAGCCTGTCCTGGAAGGG - Intronic
1072068324 10:91891921-91891943 TGCCTAAGCCTGCTCTGGAGAGG + Intergenic
1073044436 10:100628533-100628555 TGCCCCAGCCTGCAGGGGAGAGG + Intergenic
1074157630 10:110812386-110812408 TGCCCCAGTCAGCCCGGGAGGGG - Exonic
1076177297 10:128377827-128377849 TGCCCAAGCCTGTCATGGAAAGG - Intergenic
1076223175 10:128751287-128751309 AGCCCAGGCCTGACTGGGACAGG - Intergenic
1078108344 11:8372672-8372694 TTCCCAAGGCTGACTGGGACAGG + Intergenic
1079029304 11:16973895-16973917 TGTCCAAGACTGTCCAGGACTGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083423127 11:62567435-62567457 CGCCCAAGACAGCCCGGAACTGG + Exonic
1083613840 11:64016878-64016900 TGCCCAGGCTGGCCCAGGACAGG + Intronic
1083685665 11:64373513-64373535 TCCCCAGGCCTCCCGGGGACAGG - Intergenic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1084408199 11:68991168-68991190 TGCCCAAGCCCGCCTGGGAAGGG - Intergenic
1084466780 11:69327984-69328006 TGGCCAAGCCTGCTGGGCACTGG - Intronic
1084969535 11:72763135-72763157 TGTCCTAGCTTGCCTGGGACTGG - Intronic
1089299656 11:117490903-117490925 AGCCCCAGCCTGCCCTGGACTGG - Intronic
1089400411 11:118161133-118161155 TGGCCCAGCCTGCCTGGGGCGGG - Intergenic
1103700442 12:122846400-122846422 TGCCCATGCCTGGCTGGGGCTGG + Intronic
1103782782 12:123410321-123410343 TGCCCAAGCATGGAGGGGACAGG - Intergenic
1104001608 12:124863918-124863940 AGCCCAAGGCTGCCCGGGGGCGG - Intronic
1105785157 13:23740949-23740971 TGTCCAAGGCTGCCCAGGAGAGG + Intronic
1105985930 13:25567170-25567192 TTCCAAAGCTGGCCCGGGACTGG + Intronic
1106117569 13:26830515-26830537 TGGCCAAGGCTTCCCGGGAGGGG + Intergenic
1110324211 13:74195439-74195461 TTCACAAGCCTGCCAGGGAAAGG + Intergenic
1113769804 13:112900743-112900765 GGACGAAGCCTGCCCAGGACAGG - Intronic
1115918452 14:38343389-38343411 TACCCAAGCCTGCACAGCACTGG - Intergenic
1117357089 14:54934755-54934777 TGCCCACGCCTGAGCAGGACAGG + Intergenic
1119539270 14:75428125-75428147 TGCCCAGGCCTGTCCCGGCCCGG - Intronic
1120547972 14:85833222-85833244 TGCCCAACCTTGCCAGGGACTGG - Intergenic
1121272129 14:92644800-92644822 GGCCCAAGCCTGCCCATGCCAGG - Intronic
1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG + Intergenic
1124385866 15:29207806-29207828 TCCCCAGGCCTGGCAGGGACTGG - Intronic
1125412027 15:39415894-39415916 TGACCATCCCTGCCAGGGACTGG - Intergenic
1128236385 15:66070390-66070412 TGCCCAAGCCTGTCCTGGCTAGG + Intronic
1129756243 15:78101003-78101025 TGCCCAAGCCTAGCCGTGCCTGG - Exonic
1130044113 15:80430822-80430844 TGCCCACTGCTGCCCTGGACAGG - Intronic
1132209383 15:100008662-100008684 TGCCCAAGTCTCCCTGGGACAGG - Intronic
1132499498 16:279052-279074 TGCCCAATCCTGCCTAGAACTGG - Intronic
1132654904 16:1037680-1037702 GGCCCAGGCCTGACCGGGACCGG - Intergenic
1133986001 16:10668626-10668648 TGCCCAGGCCTTCCTGGGAAGGG + Intronic
1137647444 16:50088443-50088465 TGCCCAGCCATGCCCAGGACAGG + Intronic
1138565320 16:57828612-57828634 TGCCCAGGTCTGCCAGAGACGGG - Intronic
1139606633 16:68023383-68023405 TCCCCAAGGCTGGCCGGGTCTGG - Exonic
1140454763 16:75098575-75098597 TGGCCCAGTCTGCCAGGGACAGG - Intronic
1141470884 16:84237462-84237484 TGCCCATGCCTTCCAGAGACGGG - Exonic
1141893793 16:86945518-86945540 TGCCCAAGCCTCCTTGGGAGAGG + Intergenic
1203147479 16_KI270728v1_random:1810827-1810849 GGCCCAAGCTGGCCCGGAACTGG + Intergenic
1142614328 17:1125953-1125975 TGCCCAGGCCTGGCAGGGACAGG + Intronic
1147360776 17:39928155-39928177 TGGCCCAGGCTGCCCCGGACCGG + Intergenic
1147896650 17:43755801-43755823 TGGCCACCCCTGCCCTGGACCGG + Intronic
1147978342 17:44260380-44260402 TGCCCCTGCCTGCCAGGGCCTGG - Intronic
1151821919 17:76501257-76501279 TGCCCGAGCCTGCCCTGGAGCGG - Intronic
1152795550 17:82304444-82304466 GGCCCTAGCCTCCCCGTGACAGG - Intergenic
1153797158 18:8634368-8634390 TGCCCCAGCCTGCTCTGCACTGG + Intronic
1155509386 18:26561858-26561880 TGCTCACGCCAGCACGGGACTGG - Intronic
1158391969 18:57051535-57051557 GGCCCCAGCCTGCCAGGGAAGGG + Intergenic
1159121424 18:64175900-64175922 TGCCCCAGCATGCCCTGGCCAGG + Intergenic
1160328612 18:77972098-77972120 TGCCCTAGCCTGGCCTGGGCTGG - Intergenic
1160836251 19:1126084-1126106 CGCCCAAGCCTGCCTGAGCCCGG + Intronic
1162362327 19:10227551-10227573 GGCCCAAGCCTGCCTGGGACTGG - Intronic
1163321322 19:16576710-16576732 GGGAAAAGCCTGCCCGGGACAGG + Exonic
1167002754 19:46755758-46755780 TGCTCCAGCCCGCCCTGGACCGG + Exonic
925059492 2:880226-880248 GAGCCGAGCCTGCCCGGGACAGG - Intergenic
925358103 2:3256843-3256865 TGCCCAAGCCCGCCCGTGTCCGG - Intronic
929484452 2:42341414-42341436 TGCCCAAGCTTGCCTGGGCTGGG + Intronic
932702736 2:74002505-74002527 TGCCCCAGCCTGCCGGGGAGCGG + Intronic
933724304 2:85418092-85418114 TGAACAGGCCTGCCCAGGACTGG - Intronic
935649012 2:105366309-105366331 TGCCCAGGCCAGCCAGGTACAGG + Intronic
936531093 2:113277660-113277682 TGCCCAGCCCTGGCCGGGAAGGG + Intronic
948147588 2:235719680-235719702 TGCCCAAGGCTTCCTGGGTCAGG + Intronic
948852859 2:240716865-240716887 CTCCCAAGCCTGCTAGGGACAGG - Exonic
948865568 2:240773082-240773104 TGCTCCAGCCTGTCCTGGACAGG - Intronic
948888609 2:240896328-240896350 ACCCCAAGCCTGGCTGGGACAGG - Intronic
948991796 2:241559244-241559266 TCCCCGAGGCTGCCAGGGACCGG - Intronic
1172097250 20:32466523-32466545 GGCCCAAGCCTTCCAGGGATTGG - Intronic
1172620529 20:36315790-36315812 TCCCCAAGCCTTCCCGGCACTGG + Intronic
1172882967 20:38213554-38213576 GGCCCAGGCCTGCCCGGCTCAGG + Exonic
1173897468 20:46561941-46561963 GGGCCATCCCTGCCCGGGACTGG + Intronic
1175257845 20:57657710-57657732 TGTCCAGACCTGCCAGGGACAGG + Intronic
1175519510 20:59591179-59591201 AGCCCCAGCCTGCCCTTGACAGG + Intronic
1180752822 22:18136836-18136858 TGCCTACCCCTGCCCGCGACTGG - Intronic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
1183512587 22:38244800-38244822 TGCCCAGGTCTGCCCTAGACAGG - Intronic
1184089226 22:42283674-42283696 TGCCCAGCCCTGCCCTGGCCCGG + Intronic
1184225728 22:43127995-43128017 TGCCCAGGAATGCCAGGGACAGG - Intronic
1185046534 22:48531289-48531311 AGCCCCACCCTGCCCAGGACAGG - Intronic
1185299731 22:50073045-50073067 GGCCCACGCCTGCCCGGGAACGG - Intronic
1185299748 22:50073094-50073116 GGCCCACGCCTGCCCGGGAATGG - Intronic
950097423 3:10338130-10338152 GGCCCAGGCCTGGCCGGGGCGGG - Intronic
950177634 3:10886354-10886376 TGCCCAAGGCTGTATGGGACAGG - Intronic
950657382 3:14444987-14445009 TCCCCAGGCCTGCCCAGGGCAGG - Intronic
954379517 3:50212285-50212307 TGTCCCAGCCTGCCCAGGGCAGG + Intronic
955994124 3:64660561-64660583 TGCCCCATCCTGCCTGGGGCTGG + Intronic
961391809 3:126556504-126556526 TCCCCAAGCAGGCCCTGGACAGG - Intronic
961650831 3:128415968-128415990 AGCCCAAGCCTGCCAGGTCCTGG + Intergenic
965524486 3:169701706-169701728 TGCCCAACCCTGCCAGTAACAGG + Intergenic
968541215 4:1169356-1169378 AGCCCAAGCCTGCACTGGGCAGG + Intronic
968604322 4:1524745-1524767 TGCTCCATCCTGCCCCGGACAGG - Intergenic
968650523 4:1758545-1758567 TGCCCAGGCCTGTCCGGGTTGGG - Intergenic
968966681 4:3772418-3772440 TGCCCATGCCTGCCCAGGGACGG - Intergenic
969210524 4:5683754-5683776 TGCTCAAGCCAGCCCGGCCCAGG + Intronic
969614578 4:8244838-8244860 TGCCCAATCCTGCCTAGAACTGG - Intergenic
973110633 4:46392711-46392733 TGCCCAAGCCTGGATGGGAATGG - Intronic
976704510 4:88007401-88007423 TTCCCAGGCCTTCCCGGGAATGG + Intergenic
985663590 5:1169759-1169781 AGCCCAAGCCTGCCGAGCACGGG + Intergenic
985878534 5:2619442-2619464 TGCTCCAGCCTGCACGTGACAGG - Intergenic
986266719 5:6197302-6197324 TGCCCAAGGCTGCAGGGCACTGG - Intergenic
987025851 5:13925859-13925881 TGTCCCAGCTTGCCCAGGACAGG + Intronic
988277947 5:29107114-29107136 TGCCTGAGCCTGCCCAGGATAGG + Intergenic
993048052 5:82891421-82891443 TGCCCAGGCCTCTCCTGGACTGG + Intergenic
995357290 5:111253398-111253420 AGCCCAACCCTGTCCGGAACTGG - Intronic
997226117 5:132210698-132210720 GGCCCAGCCCTGCCCTGGACTGG + Intronic
1000086208 5:157889547-157889569 TCCCCATGACTGCCTGGGACAGG - Intergenic
1001451235 5:171826169-171826191 TGGCCCAGCCTGTGCGGGACAGG - Intergenic
1002173973 5:177391105-177391127 TGCCCATCCCTGCCTGGGCCTGG - Intronic
1005807552 6:29488603-29488625 TACCCAAGGATGCCCAGGACTGG - Intergenic
1005963960 6:30713313-30713335 GGCCCAAGGCCGCCCAGGACCGG + Exonic
1006459402 6:34149634-34149656 TCCCACAGCCTGCTCGGGACAGG + Intronic
1007340232 6:41186556-41186578 TGACCAGGCCTGCCTGGAACCGG + Intergenic
1011626916 6:89290526-89290548 TGCCCAAGTGTGGCCGGGAAGGG + Intronic
1012548457 6:100447445-100447467 TGAACCAGCCTGCCTGGGACTGG + Intronic
1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG + Intergenic
1017584704 6:155908064-155908086 TACTCAAGCCTGCCTGGCACTGG - Intergenic
1017751075 6:157491045-157491067 TGCCCATGCCAGCCAGTGACAGG - Intronic
1019171721 6:170136651-170136673 TGCCCAGCCCTGCGCGGCACTGG - Intergenic
1019216733 6:170448579-170448601 GGCCCACGCCTGCCAGGGCCTGG - Intergenic
1019568013 7:1694227-1694249 TCCCCAGCCCTGCCCGGCACCGG - Exonic
1019671668 7:2283311-2283333 AGGCCAAGCCCGCCCCGGACTGG + Intronic
1020070781 7:5225719-5225741 GGCCCAAGTGTGCCCGTGACAGG + Intronic
1020107805 7:5430226-5430248 TGCACAGGCCTGCCCCGGAGGGG - Intergenic
1022464640 7:30645311-30645333 TGGCCCAGCATGCCCAGGACAGG + Intergenic
1025880904 7:65535438-65535460 TGCCCCAGCCTCCCCAGTACCGG - Intergenic
1025892533 7:65667168-65667190 TGCCCCAGCCTCCCCAGTACCGG + Intergenic
1034256811 7:149729215-149729237 TCCCCTACCCTGCCCGAGACGGG - Exonic
1037529029 8:19756683-19756705 CGCGCTCGCCTGCCCGGGACCGG - Intronic
1037762553 8:21751519-21751541 TGCCCAAGGTTGCCCAGCACAGG + Intronic
1038544140 8:28412396-28412418 TGCTCAGGCCTGCCGGGGATCGG - Intronic
1040107772 8:43550016-43550038 TCCCCCCGCCTGACCGGGACAGG - Intergenic
1040965538 8:53077719-53077741 TGCCCAAGCCCCCCCGGGGTGGG - Intergenic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1041511506 8:58659353-58659375 GGCCGGAGCCTGCCGGGGACAGG - Exonic
1044803762 8:95983738-95983760 TGACCAAGACTGCCAGGGAGAGG + Intergenic
1045225639 8:100242700-100242722 TGCCCAGGCCTGCCTGAGAGAGG + Intronic
1045662987 8:104457323-104457345 TGCTCCATCCTGCCTGGGACTGG - Intronic
1047806319 8:128364511-128364533 TGCTCATGCCTTCCCAGGACAGG - Intergenic
1048857623 8:138697852-138697874 TGCCTGAGTCTCCCCGGGACTGG - Intronic
1052748140 9:32461616-32461638 TGCTCAGGCCTGCCCAGCACAGG + Intronic
1056939755 9:90945083-90945105 TGCCGAATCCTGCCCAGAACTGG - Intergenic
1059458735 9:114416136-114416158 TGCCCAAGGATGCTGGGGACAGG - Intronic
1061865850 9:133491460-133491482 AGGCGAAGCCCGCCCGGGACTGG + Intergenic
1062048955 9:134437488-134437510 TGCCCCACCCTGCCCGAGCCAGG - Intronic
1062341379 9:136095198-136095220 TGCCCAGGCCGGACCGGGCCGGG - Exonic
1187190267 X:17027969-17027991 TGGCCAAGCCTGCCTGTGACTGG - Intronic
1199263956 X:145808599-145808621 TGCCCAGCACTGCCTGGGACTGG - Intergenic
1200034583 X:153319300-153319322 TGCCCAGGCCTCCCCGGCCCAGG - Intergenic