ID: 1041497808

View in Genome Browser
Species Human (GRCh38)
Location 8:58506469-58506491
Sequence CTGCATCTCCAGCACTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041497808_1041497812 15 Left 1041497808 8:58506469-58506491 CCTTTTAAGTGCTGGAGATGCAG No data
Right 1041497812 8:58506507-58506529 GCAAAGTCGCTGCCCTCTAGGGG No data
1041497808_1041497811 14 Left 1041497808 8:58506469-58506491 CCTTTTAAGTGCTGGAGATGCAG No data
Right 1041497811 8:58506506-58506528 GGCAAAGTCGCTGCCCTCTAGGG No data
1041497808_1041497809 -7 Left 1041497808 8:58506469-58506491 CCTTTTAAGTGCTGGAGATGCAG No data
Right 1041497809 8:58506485-58506507 GATGCAGAGATAAATAAGACAGG No data
1041497808_1041497810 13 Left 1041497808 8:58506469-58506491 CCTTTTAAGTGCTGGAGATGCAG No data
Right 1041497810 8:58506505-58506527 AGGCAAAGTCGCTGCCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041497808 Original CRISPR CTGCATCTCCAGCACTTAAA AGG (reversed) Intergenic
No off target data available for this crispr