ID: 1041497809

View in Genome Browser
Species Human (GRCh38)
Location 8:58506485-58506507
Sequence GATGCAGAGATAAATAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041497808_1041497809 -7 Left 1041497808 8:58506469-58506491 CCTTTTAAGTGCTGGAGATGCAG No data
Right 1041497809 8:58506485-58506507 GATGCAGAGATAAATAAGACAGG No data
1041497806_1041497809 7 Left 1041497806 8:58506455-58506477 CCTTATGCAAGGCACCTTTTAAG No data
Right 1041497809 8:58506485-58506507 GATGCAGAGATAAATAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041497809 Original CRISPR GATGCAGAGATAAATAAGAC AGG Intergenic
No off target data available for this crispr