ID: 1041497811 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:58506506-58506528 |
Sequence | GGCAAAGTCGCTGCCCTCTA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1041497806_1041497811 | 28 | Left | 1041497806 | 8:58506455-58506477 | CCTTATGCAAGGCACCTTTTAAG | No data | ||
Right | 1041497811 | 8:58506506-58506528 | GGCAAAGTCGCTGCCCTCTAGGG | No data | ||||
1041497808_1041497811 | 14 | Left | 1041497808 | 8:58506469-58506491 | CCTTTTAAGTGCTGGAGATGCAG | No data | ||
Right | 1041497811 | 8:58506506-58506528 | GGCAAAGTCGCTGCCCTCTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1041497811 | Original CRISPR | GGCAAAGTCGCTGCCCTCTA GGG | Intergenic | ||