ID: 1041503654

View in Genome Browser
Species Human (GRCh38)
Location 8:58569052-58569074
Sequence TTTTCCCCCAAAACGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041503652_1041503654 4 Left 1041503652 8:58569025-58569047 CCTAGCTAGTTTAAAAAGAAAAT 0: 1
1: 1
2: 43
3: 252
4: 1455
Right 1041503654 8:58569052-58569074 TTTTCCCCCAAAACGGAGTCTGG No data
1041503651_1041503654 9 Left 1041503651 8:58569020-58569042 CCACACCTAGCTAGTTTAAAAAG 0: 1
1: 1
2: 21
3: 275
4: 1618
Right 1041503654 8:58569052-58569074 TTTTCCCCCAAAACGGAGTCTGG No data
1041503650_1041503654 12 Left 1041503650 8:58569017-58569039 CCACCACACCTAGCTAGTTTAAA 0: 1
1: 13
2: 284
3: 1920
4: 12830
Right 1041503654 8:58569052-58569074 TTTTCCCCCAAAACGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041503654 Original CRISPR TTTTCCCCCAAAACGGAGTC TGG Intronic
No off target data available for this crispr