ID: 1041503826

View in Genome Browser
Species Human (GRCh38)
Location 8:58571435-58571457
Sequence CTCTGAACCTTGAAGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 353}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041503826 Original CRISPR CTCTGAACCTTGAAGAAAAA GGG (reversed) Intronic
900539297 1:3194818-3194840 CTGGGAACCTTGGAGAGAAAGGG - Intronic
902759496 1:18571904-18571926 CTCTGAACCTTGAAAGACAAGGG + Intergenic
905656649 1:39690283-39690305 CTCTGATCCTTCATGAAAATGGG - Intronic
906948752 1:50317482-50317504 CTCTGAAATATGAAGAAAAAAGG - Intergenic
907350058 1:53821654-53821676 CTCTGAACCTTTGTGAAGAATGG - Intronic
908275469 1:62466405-62466427 GCCTGAACCTTGAAGGGAAAAGG + Intronic
908425983 1:64007980-64008002 CTCTGAATCTAAAATAAAAATGG - Intronic
908808205 1:67952370-67952392 CTTTGAAGCTGGAAGACAAAAGG - Intergenic
910614775 1:89185504-89185526 CTCTGACTCCTGAAGAAAATTGG - Intronic
911819071 1:102393204-102393226 CTATGAACACTGAAGAAAACAGG + Intergenic
912326599 1:108769389-108769411 GTCTGACCCTTGAACAACAAGGG - Intronic
913303204 1:117395534-117395556 CCCTGATCCTTGAAGAGCAAGGG - Intronic
913565147 1:120066333-120066355 CTGTAAACCTTGAAAAAATATGG + Intronic
913632981 1:120727227-120727249 CTGTAAACCTTGAAAAAATATGG - Intergenic
914285737 1:146225689-146225711 CTGTAAACCTTGAAAAAATATGG + Intronic
914384046 1:147150356-147150378 CTCTGAAAGATGAAGAGAAAAGG - Intergenic
914546769 1:148676441-148676463 CTGTAAACCTTGAAAAAATATGG + Intronic
914619795 1:149394227-149394249 CTGTAAACCTTGAAAAAATATGG - Intergenic
915511939 1:156391300-156391322 CACTGAGCCTTGCAGAGAAAAGG + Intergenic
915568021 1:156727466-156727488 CTCTGAACCTTCAAAGAAAGGGG - Exonic
915792292 1:158686514-158686536 TTCTAAACCTTTAGGAAAAATGG - Exonic
916484514 1:165246665-165246687 CTCTGAAACTGGAAAAAAATAGG + Intronic
916680425 1:167099499-167099521 ATCTGAACATAGAAGAATAAAGG + Intronic
917886857 1:179394735-179394757 CTTTTAACCTTGAAGCAAGATGG + Intronic
918019994 1:180678178-180678200 CTCTGAACCTTGATGTTTAAGGG + Intronic
918221159 1:182437956-182437978 AGCTGAAACTTGAAGGAAAAAGG + Intergenic
920628847 1:207631688-207631710 CTCTGAATTTTAAAGAAAAATGG - Intronic
921967587 1:221106948-221106970 CTCAGAATTTTGAAGAAAATAGG - Intergenic
922006277 1:221533755-221533777 TTATGAATCTTGGAGAAAAATGG + Intergenic
923143294 1:231179787-231179809 CTCTGAAGCTAGCAGAAAAGTGG + Intronic
923386988 1:233474426-233474448 TCCTGAACCATGAAGAAAAGAGG + Intergenic
923812804 1:237338750-237338772 CCCTAAAGCTTGAACAAAAAAGG - Intronic
924397806 1:243642046-243642068 CTCTCAATCTTTAAAAAAAAGGG + Intronic
1064909130 10:20381417-20381439 CTCTGATCCTTGAAGCCCAAGGG + Intergenic
1064947216 10:20804576-20804598 CACTGAAACATAAAGAAAAATGG + Intronic
1067107183 10:43374216-43374238 CTCTGCCCCCTGAAGAAACAGGG - Intronic
1067950178 10:50728066-50728088 CTCTAAACCTTGGGGTAAAAAGG - Intergenic
1068287389 10:54957949-54957971 CTCTCTACCAGGAAGAAAAAAGG + Intronic
1070302344 10:75212819-75212841 ATTTGAGCCTTTAAGAAAAACGG + Intronic
1070885506 10:79893272-79893294 CTCTAAACCTTGGGGTAAAAAGG - Intergenic
1072267354 10:93743629-93743651 CTCTGACCCTTAAAATAAAATGG + Intergenic
1072431620 10:95377362-95377384 CTTTGCAGCTTGTAGAAAAATGG + Intronic
1073173836 10:101537851-101537873 CTATGTACCTTGAGGAAACATGG + Intronic
1074748726 10:116562376-116562398 CACTGAACATTGAGGAATAAGGG + Intronic
1075353178 10:121744741-121744763 CTGTGTACCCTGAAGAAAACCGG - Intronic
1076545475 10:131242939-131242961 CTCAGAAAGTTGAAGAAATAGGG + Intronic
1076552710 10:131293897-131293919 CTATCAACCTTGAAGTTAAAAGG - Intronic
1079277737 11:19057418-19057440 CTCTGCATCTTGGAGGAAAAGGG + Intronic
1080305479 11:30830360-30830382 CTCTGAACATTTAAGAATGAGGG - Intronic
1082241302 11:49874003-49874025 CTCTGAGATTTGAAGAAGAAGGG - Intergenic
1082820038 11:57538505-57538527 CTGTGCACCTAGAAGAAAGAGGG + Intergenic
1083110329 11:60400082-60400104 CTCTGGGCCTTGAAGAGAAGAGG - Intronic
1085977974 11:81683165-81683187 GTTTGAACCTTAAAGAAAGAAGG + Intergenic
1087283387 11:96237761-96237783 CTGTGAGCCTTGAAGAAAGTAGG - Intronic
1088015355 11:105051823-105051845 CCCTGAGCCTTGAACAGAAATGG - Intronic
1088768344 11:113007771-113007793 CTCTAAGCCTTGAAGAACACTGG - Intronic
1088818673 11:113438531-113438553 CTCTGAAGCATGCAGAAAATTGG - Intronic
1089190156 11:116647907-116647929 CCCTGAACCCTGAAGAACACAGG - Intergenic
1089909576 11:122083294-122083316 CTATGAACCTAGAATTAAAAAGG + Intergenic
1090460432 11:126886944-126886966 CTTTCAACATTCAAGAAAAAAGG + Intronic
1091884171 12:4003823-4003845 CTCTGGACTTTTCAGAAAAAAGG - Intergenic
1092944031 12:13436613-13436635 CTCTGAACCTGCAAGATAAATGG - Intergenic
1093187348 12:16035909-16035931 CTGTGAACCTGGAATAAACAAGG - Intronic
1093210608 12:16303678-16303700 CTCCGGACCTTGGAGAAAAGTGG + Intergenic
1093475367 12:19548786-19548808 TTCTGAACCTAAAATAAAAATGG - Intronic
1093929809 12:24944209-24944231 CCTTGAACTTTGAAGATAAAAGG - Intronic
1094719165 12:33044820-33044842 CTCTGGTACATGAAGAAAAAAGG + Intergenic
1095619863 12:44239097-44239119 CTCTGAACCTAGAATAAATAAGG - Intronic
1095632805 12:44398170-44398192 ATCTGGACATTGAAGAAAACAGG + Intergenic
1096454655 12:51774949-51774971 CTTGGAACCTGGAGGAAAAAAGG - Intronic
1097857124 12:64475275-64475297 CTCTGAATCTAAAATAAAAATGG - Intronic
1099145404 12:79037282-79037304 GTATGTACCTTGAAAAAAAAAGG - Intronic
1100675982 12:96868532-96868554 CACTGAACCATAAACAAAAATGG - Intronic
1101259786 12:103017295-103017317 ATATGAAACTTGAAAAAAAAAGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1104071958 12:125353618-125353640 CTCTGTGCCTCAAAGAAAAAAGG - Intronic
1105392687 13:19995684-19995706 CTATCAACCTTCAAAAAAAAAGG - Intronic
1106374512 13:29172085-29172107 CTGTGAAGCTTGGAGAGAAAAGG + Intronic
1106438399 13:29743749-29743771 CAGTCAACCTTGCAGAAAAAAGG + Intergenic
1106572949 13:30945437-30945459 CTATGAACATTGAACATAAATGG - Intronic
1106827316 13:33538142-33538164 CTCTGAACCGTGAAGAACTAGGG + Intergenic
1107690996 13:42952832-42952854 CTCTGAATCTTAAAGCAAGAAGG + Intronic
1107992022 13:45827011-45827033 CTGTTAGCCATGAAGAAAAAAGG - Intronic
1108315830 13:49236257-49236279 CTGTGAACCTAGAAGCAAGACGG + Intergenic
1108368971 13:49747992-49748014 CTCTGAATCTTAAGGAGAAAGGG + Intronic
1108584792 13:51861710-51861732 TTCTGAAATTTGATGAAAAACGG + Intergenic
1109793509 13:67279611-67279633 CTCTGAAACTGAAAGAAAACAGG - Intergenic
1110444805 13:75567494-75567516 CTCTGAACATAGAAAAGAAATGG - Intronic
1111899414 13:94182602-94182624 TCCTAAACCTTGAAGAAAAGTGG + Intronic
1113191667 13:107755428-107755450 AACTGAACCTTGAAGATACATGG - Intronic
1114303346 14:21397945-21397967 CTCATAGCCTAGAAGAAAAAGGG + Exonic
1115287997 14:31738845-31738867 CCCTGAAACTTGATGAAACAGGG - Intronic
1115412976 14:33096370-33096392 CTTTGAACATTTAACAAAAAAGG - Intronic
1116199854 14:41778194-41778216 GTCTGAATCTAGAAGAAAATAGG + Intronic
1117550106 14:56826485-56826507 TTGTTAACCTTGAAGAAGAATGG + Intergenic
1118026227 14:61771789-61771811 CTTTGAAACTTGAGGAAAGAAGG + Intronic
1120209537 14:81621316-81621338 TTCTGAGCCTTGAAGTGAAAAGG - Intergenic
1122095064 14:99364440-99364462 CTCTGCAAGTTGAAGGAAAAGGG + Intergenic
1126072876 15:44881532-44881554 CTCTGAAGCTTCCAGAAGAATGG + Intergenic
1127131341 15:55867742-55867764 CTCTGTGATTTGAAGAAAAAAGG + Intronic
1128879673 15:71231604-71231626 CTCTGAGCCTTTAGGAAAGAAGG - Intronic
1128979888 15:72178495-72178517 TGCTGAAACTTGAAGATAAAAGG + Intronic
1129694277 15:77731719-77731741 CTCTGAGCCTAGAGGAAATAAGG - Intronic
1130328201 15:82898415-82898437 CTCTGAACATTGAACATCAAAGG - Intronic
1131759816 15:95609937-95609959 CACTAAACCTTGAAGAAAATGGG + Intergenic
1134420132 16:14079275-14079297 TTGTGAACCTGGAAAAAAAAAGG - Exonic
1135622835 16:23970555-23970577 TTCTGCCCTTTGAAGAAAAATGG - Intronic
1135899135 16:26440197-26440219 ATCTGGACCTTGAAGAACTAAGG - Intergenic
1138269606 16:55685708-55685730 CTCTGAATTTTTGAGAAAAAAGG + Intronic
1140397028 16:74636338-74636360 CTCTTTACCTGGAAGAAAAGAGG + Exonic
1140898412 16:79346457-79346479 CTCTGAAATCAGAAGAAAAAGGG + Intergenic
1141014580 16:80437112-80437134 CCCTGAAGCACGAAGAAAAAGGG + Intergenic
1141308172 16:82886891-82886913 CTCTGCTCATTGAAGAAAAATGG + Intronic
1141735680 16:85850923-85850945 AAAAGAACCTTGAAGAAAAAGGG + Intergenic
1141888819 16:86912720-86912742 CTCTGAACCATTAAGAAAGATGG + Intergenic
1142001650 16:87667656-87667678 CTCTGGGCCTTGAAGATGAAGGG + Intronic
1143303485 17:5928119-5928141 CTCTCAGCCTTGCAGATAAAAGG + Intronic
1143460340 17:7099832-7099854 CTCTCAGCCTTCAAGGAAAATGG - Intergenic
1144097858 17:11918038-11918060 CTCAGAACGTTGGAGAGAAAAGG - Intronic
1145961148 17:28887173-28887195 CACTGAGCCTGGAAGAAGAATGG + Intronic
1146499586 17:33352904-33352926 ATCTGAACCTTGAAGAATGAGGG - Intronic
1147027759 17:37603099-37603121 CTCTGAGCCTGGAAAGAAAAAGG + Intronic
1148552435 17:48558537-48558559 CTCTGAGAATGGAAGAAAAAAGG - Intronic
1148570339 17:48663197-48663219 CTCTGACCCTTTAAGAGAGATGG + Intergenic
1149991038 17:61383722-61383744 TTCTTAACCTTGATGGAAAAGGG + Intronic
1150855925 17:68752746-68752768 CCCTGAACCTATAATAAAAATGG - Intergenic
1152372048 17:79894736-79894758 CTATGAACCATGAAGAATCAAGG - Intergenic
1153728793 18:7986059-7986081 CTTTGAAGTTTGAAGATAAAAGG + Intronic
1153861563 18:9215308-9215330 CCCTGAACCCTGAAGGGAAAAGG + Intronic
1153938067 18:9949260-9949282 CTGGGAAGCTTGAAGAAGAATGG + Intronic
1154062029 18:11071183-11071205 CTTTGAACCTTTAAGAAAGGAGG - Intronic
1154316274 18:13306253-13306275 CCCTGAGCCTTGAAGGAAAAAGG + Intronic
1155940595 18:31798748-31798770 CTGTGAACCTAGGGGAAAAAAGG + Intergenic
1156719698 18:40054928-40054950 CTCTGCTCCTTGCAAAAAAATGG - Intergenic
1157110779 18:44818297-44818319 CACCGAACCTTAAAGAAAGAAGG + Intronic
1157951521 18:52043582-52043604 CTCTGACCCATGGAGACAAATGG - Intergenic
1158003446 18:52645294-52645316 CTCTCAGCCTTAAAGAGAAATGG + Intronic
1158259593 18:55592125-55592147 CTGTGAAACTTAAATAAAAAAGG + Intronic
1158367800 18:56758572-56758594 ATCTGAATATTGAAGAACAAAGG + Intronic
1159210659 18:65317120-65317142 TTCTGAACAATGAAGAAAAGAGG - Intergenic
1159465595 18:68779079-68779101 CTGTCAACCTCGTAGAAAAAAGG - Intronic
1160422599 18:78757356-78757378 AGCTGAATCCTGAAGAAAAATGG + Intergenic
1161833964 19:6632341-6632363 TTCTGAACTCAGAAGAAAAACGG + Intergenic
1162387616 19:10369363-10369385 CCCTGACCCTTAAAAAAAAAAGG - Intronic
1163896171 19:20061851-20061873 CTCTGAAACTTGGAGAAATGTGG + Intergenic
1166736797 19:45090738-45090760 CTCTGAACCCTACAGAAATATGG + Exonic
1166939550 19:46354483-46354505 ATCTGCACTTTGAAGAAAAGAGG + Intronic
925155397 2:1645654-1645676 CATTGAACTTAGAAGAAAAAGGG - Intronic
925438191 2:3859665-3859687 CTCTGAAAATTGAGAAAAAAAGG + Intergenic
927440388 2:23112017-23112039 CTCTGAAGTCTGAAGAGAAAGGG - Intergenic
928387237 2:30880965-30880987 CTCTGCACCTGGAAGAGATAAGG + Intergenic
928927079 2:36590903-36590925 CTCTGAACCTCTCAGAAAAAGGG - Exonic
928929376 2:36608513-36608535 CTGTGAACCTTCAAGAAAACAGG + Intronic
928970273 2:37021108-37021130 TTCTGATCCTTTAAGAACAAAGG + Intronic
929034997 2:37682148-37682170 TTCTGAACCTCAAAGCAAAATGG + Intronic
929834910 2:45386554-45386576 GACTGAACATTGAAGAGAAAGGG - Intergenic
932396181 2:71450141-71450163 CTCTAAAGCTTCCAGAAAAAAGG + Intergenic
932623929 2:73283848-73283870 CTCTGGACCTTGGAGAACAGGGG - Intronic
932829702 2:74977357-74977379 CTTGGAATCTTCAAGAAAAATGG + Intergenic
933001776 2:76933909-76933931 CTCTTAATATTGAAGTAAAATGG - Intronic
933098906 2:78225332-78225354 CTCTCAACCTTATAGAAAAATGG - Intergenic
933313178 2:80685839-80685861 CTCTGAAAAGTGAAGAGAAAAGG + Intergenic
933370720 2:81412038-81412060 CTCTGAACTTTGAGAAAAGAAGG + Intergenic
933836516 2:86250308-86250330 CTCTGAAGCCTGAGGAAAACAGG - Intronic
933971159 2:87470766-87470788 CTCTGAACCTAGCAGAAGCACGG + Intergenic
935154625 2:100472373-100472395 CTTTGAACTTTGAAGACACATGG - Intronic
936226114 2:110654053-110654075 CTATAATCCTTCAAGAAAAAAGG + Intronic
936322570 2:111479423-111479445 CTCTGAACCTAGCAGAAGCACGG - Intergenic
937782270 2:125852654-125852676 CTCCAAACCTTGAAGACAACTGG - Intergenic
938869660 2:135462101-135462123 ATCTGAAACTTGAACAAATAAGG - Intronic
939534145 2:143404178-143404200 TTCTGAACCTTGAAGGACAAGGG + Intronic
939918641 2:148080874-148080896 ATCAGAATCTAGAAGAAAAAAGG - Intronic
940080723 2:149797975-149797997 CTCAGAATCTTGTAGAAAAATGG + Intergenic
940774340 2:157871308-157871330 CTCTGAGCCTTGAAGAATCTGGG + Intronic
941128791 2:161620700-161620722 CACTTAACCATTAAGAAAAAGGG - Intronic
941797892 2:169621479-169621501 TACTGAATCTTCAAGAAAAAAGG - Intronic
943890283 2:193277361-193277383 CTCAGAAACTAGATGAAAAAAGG - Intergenic
944119202 2:196222863-196222885 ATAAGAACCATGAAGAAAAAGGG - Intronic
945350340 2:208770669-208770691 CTATGATCCTTTAAGAAATAAGG + Intronic
946954807 2:224917589-224917611 ATCTGAACCTTGAAAAAAATAGG + Intronic
1169162974 20:3398105-3398127 CTCTAAAGCTAGAAGAGAAATGG + Intronic
1169750156 20:8983635-8983657 CTCTGACCTCTCAAGAAAAAAGG + Intergenic
1170328838 20:15185843-15185865 CTTTGAAACTTGATGATAAATGG - Intronic
1172945377 20:38683613-38683635 CTCTGAATCTTTAACATAAATGG + Intergenic
1174789949 20:53468915-53468937 ATCAGACCCTTGAAGAATAAGGG - Intronic
1175012942 20:55758134-55758156 CTCTGAACCCAAAAGGAAAAAGG + Intergenic
1176511651 21:7752912-7752934 ATGTGAACCTTCAAGAAAACAGG + Intronic
1177960352 21:27658578-27658600 GAATGAAACTTGAAGAAAAAAGG - Intergenic
1178645765 21:34383440-34383462 ATGTGAACCTTCAAGAAAACAGG + Intronic
1179136767 21:38686477-38686499 CCCTGTCCCTTGAAAAAAAAAGG + Intergenic
1180980280 22:19875196-19875218 CTCTGCACCTTGAAGCAAGAAGG - Intergenic
1181337683 22:22153111-22153133 CTCTGTCCTTTGATGAAAAAGGG - Intergenic
1181910169 22:26232186-26232208 CTCTGAAACCAGAAGAAGAATGG - Intronic
1182994935 22:34803292-34803314 CTCTGGACCATGGAGGAAAAGGG + Intergenic
1183843797 22:40523102-40523124 CTTTGAAAAATGAAGAAAAATGG + Intronic
1184411972 22:44331139-44331161 CGCTGAACCTTGGAGAGGAAGGG - Intergenic
949840989 3:8319765-8319787 GGCTGAACAGTGAAGAAAAAGGG - Intergenic
950859791 3:16137802-16137824 CTCTGAACCTAGAAGTCTAACGG - Intergenic
951081052 3:18450059-18450081 CACTGCACCTTGAAAAAGAACGG - Intergenic
951822222 3:26825979-26826001 CTCTGATCCCTGAAAAAAAGTGG - Intergenic
951832293 3:26943778-26943800 CTCAGAACCTTGATAAAAAGGGG + Intergenic
951832884 3:26950118-26950140 TTCTGAATCTTCCAGAAAAAGGG + Intergenic
953039847 3:39246207-39246229 CTCTGAACCTAAAAGAAAGTTGG - Intergenic
953090417 3:39719118-39719140 CTCTGAAGTGTGAAGACAAACGG - Intergenic
953778870 3:45847700-45847722 CTCTGAGCCTTGAAGGAAAAAGG - Intronic
954363695 3:50135366-50135388 CTCTGACCCTAAAGGAAAAACGG - Intergenic
954807149 3:53227156-53227178 CCCACAACCTTGAAGACAAAGGG + Intronic
955626306 3:60923333-60923355 CTCTGAGAAATGAAGAAAAATGG - Intronic
956861286 3:73326575-73326597 ATCTGAAGCTTTAAGCAAAAGGG + Intergenic
959073595 3:101726579-101726601 CACTGATCCTTGAAAAGAAACGG - Exonic
959587936 3:108042638-108042660 CCCTGAACCTGGAAGAAAATGGG + Intergenic
960363542 3:116743541-116743563 CTCTAAAAGTTGAAGAAGAATGG + Intronic
960394434 3:117118958-117118980 CTCTGATTTTTGAGGAAAAAGGG + Intronic
962864411 3:139435330-139435352 TACTGCAGCTTGAAGAAAAAGGG - Intergenic
964629735 3:158797568-158797590 CTGTGAAACTGGGAGAAAAAGGG + Intronic
964981847 3:162692545-162692567 CTATGTACTTTGAAGAAAAGGGG - Intergenic
965695777 3:171406928-171406950 GACTGTACCTTGAAGAAAGAAGG + Intronic
967313043 3:188124425-188124447 CTCTGACCCTAGAAACAAAATGG - Intergenic
967563790 3:190949898-190949920 CTCTTAATCTTGATGAAACAAGG - Intergenic
969043948 4:4322944-4322966 CTCAGAACCTAGAAGCAAATAGG + Intergenic
969324835 4:6436669-6436691 CTCTGGACCTTTATGGAAAAAGG - Intronic
969872353 4:10112530-10112552 TTCTTAAACTTGTAGAAAAAGGG - Intronic
969911000 4:10446182-10446204 CTCTGAGCCTTGATACAAAAGGG + Exonic
972141183 4:35961492-35961514 ATCTGATCCATGAAGTAAAATGG + Intronic
972852351 4:43066617-43066639 CTCTGAATCATGAATAAACAGGG + Intergenic
973821313 4:54664142-54664164 TTCTGAACCTTAAAGGAAGAGGG + Intronic
973978735 4:56288245-56288267 CTCTGAATCTGAAATAAAAATGG - Intronic
974652477 4:64773154-64773176 CTTTAAATATTGAAGAAAAATGG - Intergenic
974928868 4:68337449-68337471 CTCTGATGTTTAAAGAAAAAGGG + Exonic
975023702 4:69522008-69522030 CTCTAAATCTTGGATAAAAAAGG - Intronic
975083234 4:70305610-70305632 CCCTGAACCTAAAATAAAAAAGG + Intergenic
975694211 4:76995601-76995623 CTCTGCATCTTGAGAAAAAAAGG + Intronic
975746323 4:77478902-77478924 CCCTGAAACTAAAAGAAAAATGG + Intergenic
976154032 4:82123474-82123496 TTCTTAACCTGGAAGCAAAATGG + Intergenic
976425036 4:84893348-84893370 TTGTGAACCTTGAAGCAAATTGG - Intronic
977744275 4:100526755-100526777 CTCTAACTCTTGAAGGAAAATGG + Intronic
978051766 4:104209551-104209573 CTCTGAACCTGGGAAAAATAAGG - Intergenic
978453485 4:108862624-108862646 CTCAGAATAATGAAGAAAAATGG + Intronic
980598149 4:134983050-134983072 CCCTGGACCTTGAACAAAAAAGG + Intergenic
981642257 4:146958182-146958204 ATCTGAACCATCAAGAGAAAAGG + Intergenic
982190764 4:152853305-152853327 CGCTAAACCTGGAAGCAAAAGGG - Intronic
982267188 4:153548792-153548814 GTTTGTACCTTCAAGAAAAATGG + Intronic
984022411 4:174502186-174502208 TTCTCCAACTTGAAGAAAAAAGG + Intronic
985090268 4:186355415-186355437 CTCTGAAACTTGTAGGAGAAAGG + Intergenic
986091241 5:4510393-4510415 CTCAGATCTTTGAGGAAAAATGG + Intergenic
986702584 5:10425480-10425502 CTCTGTAAATTTAAGAAAAATGG + Intronic
986830484 5:11571948-11571970 CTCTCAAACTTGATGAAATATGG + Intronic
988126333 5:27043046-27043068 CCCTGAACAATGAAGAAAAAAGG - Intronic
988233733 5:28511159-28511181 TTCTGAACTTTGAGGCAAAATGG + Intergenic
989359026 5:40578357-40578379 CTATGAACATTAAAAAAAAAAGG - Intergenic
990516850 5:56538510-56538532 CTCTGCTCCCTGAAGAAACAGGG - Intronic
993234593 5:85288160-85288182 CTATGAAGCTTGAATAAAATTGG + Intergenic
993352657 5:86868911-86868933 CTATGAAGCTAGAAGCAAAATGG + Intergenic
993909332 5:93662271-93662293 CTCTGTTCCTTGTAGATAAAAGG + Intronic
994699974 5:103121010-103121032 TTCTGCGCCTTGAAGAAGAAGGG + Intronic
995088378 5:108141839-108141861 CACTGAAGCTTGAAGGATAAGGG - Intronic
995921177 5:117315060-117315082 TTTTAAACCTTGAAAAAAAATGG - Intergenic
996013629 5:118507453-118507475 TTATCATCCTTGAAGAAAAATGG - Intergenic
996179033 5:120396162-120396184 CACTGAAAATTAAAGAAAAATGG - Intergenic
997455021 5:134010272-134010294 CTCACAACCTTGAGGAAATATGG + Intergenic
998548983 5:143058262-143058284 CAATGATCCTTGTAGAAAAAGGG - Intronic
998788453 5:145738319-145738341 ATCTCAACCTGAAAGAAAAAAGG + Intronic
1000584676 5:163082535-163082557 ACCTGAACCTAGCAGAAAAAAGG + Intergenic
1001727946 5:173923105-173923127 TTCTGAACCTTAATGAAAAATGG - Intronic
1002055898 5:176597728-176597750 CTCTGCACCTTCCAGAAAAACGG - Exonic
1002917038 6:1537735-1537757 CTCTGTACCTTGCAGACAATGGG - Intergenic
1003036104 6:2641663-2641685 TTCTGAGACTTGAAGAAAAGAGG - Intergenic
1003748894 6:9033615-9033637 CTCAGTACTTTGAAGAATAAGGG - Intergenic
1006835186 6:36994370-36994392 CCCTGAACCTTCAAAATAAAGGG - Intergenic
1007289139 6:40771819-40771841 CTCTGTATCATGAAGGAAAAAGG - Intergenic
1007352816 6:41286527-41286549 CTCTGAAGCTTCAACAGAAAAGG + Intronic
1008437483 6:51493590-51493612 ATCTGAAACATGAAGAACAATGG + Intergenic
1008883522 6:56407011-56407033 CTCTGTAGCTTTAAGAATAAAGG + Intergenic
1010391888 6:75347098-75347120 CTCTGTGCATTGAAGAAATAAGG + Intronic
1011464420 6:87640768-87640790 CACTGAACCTTGCATAAATAAGG + Intronic
1011518225 6:88175771-88175793 CTCTGTAACTTAAAAAAAAAAGG - Intergenic
1011527420 6:88280277-88280299 CTCTGAACCTTAAAAGAAAAAGG - Intergenic
1011567185 6:88688725-88688747 CTCTGACCCTTGAATAACATGGG + Intronic
1012201173 6:96407775-96407797 CTCTTAACCTAAAAGAATAATGG + Intergenic
1012347671 6:98211383-98211405 CTGTAAAACTTGAAGAAAACAGG + Intergenic
1012792817 6:103720672-103720694 GTTTGAACAGTGAAGAAAAAAGG - Intergenic
1013936305 6:115599447-115599469 CTCTGAACTTTGAAAAACACAGG + Intergenic
1014302407 6:119698970-119698992 TTTTGAACATGGAAGAAAAAAGG - Intergenic
1014722982 6:124940554-124940576 CTCTGAGCCTTAAAGAATACTGG - Intergenic
1016156378 6:140814268-140814290 CTCTGGACATTGAATATAAATGG - Intergenic
1019403423 7:869109-869131 ACCAGAACCTTAAAGAAAAATGG - Intronic
1019974463 7:4569562-4569584 CTCTGAACCTGCTAGGAAAATGG - Intergenic
1020599743 7:10257853-10257875 CTCTGAAAATTGAAGTAAAGTGG + Intergenic
1020735179 7:11939413-11939435 CACTGAAACTTAAAGACAAAGGG + Intergenic
1020892423 7:13895806-13895828 CTCTGTATCTTGCAGAAAAAAGG + Exonic
1021256465 7:18398410-18398432 TTCTGAAATTTGAAGTAAAAGGG - Intronic
1021352835 7:19616613-19616635 CTCTTACCCTCGAAGGAAAAAGG - Intergenic
1022093924 7:27126161-27126183 CTCTCCCCCTTGAAGAAAAATGG - Intronic
1022200466 7:28111879-28111901 CTCTGATGCTTGCAGAAATATGG - Intronic
1022592265 7:31675619-31675641 CTCAGAAACTTGAAAAAGAAAGG + Intergenic
1022597406 7:31725607-31725629 CTTTGAATGTTGAAGTAAAAAGG + Intergenic
1022837984 7:34135191-34135213 CTGTGAATCATGAACAAAAATGG + Intronic
1023514172 7:40984033-40984055 CTCTGAACCTGGAAGTAACGTGG - Intergenic
1025009748 7:55386597-55386619 TTCTGGACCCTGAAGAAAGACGG + Intronic
1025227705 7:57178889-57178911 ATCTGAACCTTGAAAACCAAGGG + Intergenic
1026245269 7:68614138-68614160 ATCTGAACTCTGAAGAGAAATGG + Intergenic
1027672729 7:81121560-81121582 TTCAGGACCTTGAAGATAAAGGG - Intergenic
1027955020 7:84866604-84866626 CAGAGAATCTTGAAGAAAAATGG - Intergenic
1030101693 7:105952567-105952589 CACAGCACCTGGAAGAAAAAAGG - Intronic
1030209556 7:106982573-106982595 TTCAGAAGCTGGAAGAAAAAAGG + Intergenic
1031601350 7:123714494-123714516 ATCTCAACAGTGAAGAAAAACGG + Intronic
1031959661 7:127977128-127977150 CTCTCAACAGTGCAGAAAAAGGG + Intronic
1032459714 7:132101672-132101694 CTCTGAAGCTGGTAGAAAGAGGG - Intergenic
1034148409 7:148892778-148892800 CTGTGAAACTTGAACAAATATGG + Intergenic
1035826526 8:2650277-2650299 CTCTGAGACTTGGAGATAAAGGG - Intergenic
1035907539 8:3530189-3530211 ATCTGAAGCTTGCAGAAAGAAGG - Intronic
1036095577 8:5721529-5721551 CTGTGAAACTTGTAGAAAAAAGG + Intergenic
1036205367 8:6801857-6801879 CTAGGAACAGTGAAGAAAAAGGG - Intergenic
1036489943 8:9215534-9215556 GTCTAATCCTTGAAGAAAGAGGG - Intergenic
1036514384 8:9430202-9430224 TTCTGGACTATGAAGAAAAATGG + Intergenic
1036664323 8:10729213-10729235 CTCTGAACTCCGACGAAAAAAGG + Intronic
1036787032 8:11694749-11694771 CTGTGATCATGGAAGAAAAATGG - Intronic
1037250097 8:16882065-16882087 CTCTGTCTCTTAAAGAAAAAGGG + Intergenic
1038069231 8:23995030-23995052 TTCTGAAGCAGGAAGAAAAAGGG + Intergenic
1038306858 8:26412527-26412549 CACTGATGCTTTAAGAAAAAGGG - Exonic
1039160082 8:34608332-34608354 GTTTGTACCTTCAAGAAAAATGG - Intergenic
1041286761 8:56271042-56271064 GCCTGAACCTTGAAGAAGAAGGG + Intergenic
1041503826 8:58571435-58571457 CTCTGAACCTTGAAGAAAAAGGG - Intronic
1041878033 8:62712658-62712680 CTCTCAGCCTTGAAAGAAAAGGG + Intronic
1042277151 8:67017830-67017852 TTCTGAAGATTAAAGAAAAAAGG + Exonic
1044011527 8:86999678-86999700 CTCTGAAGTTTGAGGAAATAAGG - Intronic
1044198267 8:89403769-89403791 CTCTGAAGCTTCCAGAAGAATGG - Intergenic
1045045324 8:98269694-98269716 CCCTGAATCTAAAAGAAAAATGG - Intronic
1046009293 8:108527083-108527105 TTCTGAACCTTTTAGCAAAATGG - Intergenic
1046084758 8:109418349-109418371 TTATGAACCCTGAAGAAAATGGG + Intronic
1050221300 9:3393624-3393646 CTCTGAACCTTATTGAGAAAGGG - Intronic
1050998661 9:12252602-12252624 CTATCAACTTTGAAGAAAACTGG - Intergenic
1052206218 9:25844268-25844290 CTCATTATCTTGAAGAAAAAGGG + Intergenic
1052955391 9:34249923-34249945 CTCAGAGCCATGAAGAAGAAAGG + Exonic
1053234767 9:36443028-36443050 ATGTGAACCTAGAAGAAAAGAGG + Intronic
1053405071 9:37866673-37866695 CTGTGAACCTTTCAGAAAAGTGG - Intronic
1054932863 9:70654252-70654274 TTCTCAGCCTTGAAGAGAAAGGG + Intronic
1055136590 9:72836386-72836408 TTCTGAACTTAGAGGAAAAAGGG - Intergenic
1055184391 9:73433126-73433148 CTCTCACTGTTGAAGAAAAAAGG - Intergenic
1055277620 9:74636877-74636899 GTCTGAACCTTGATTAGAAAGGG + Intronic
1055550844 9:77431112-77431134 CTGTTACCCTTGGAGAAAAAGGG - Intronic
1055709031 9:79038409-79038431 CTCAGAAACTTAAAAAAAAATGG - Intergenic
1056090359 9:83199665-83199687 CTCAGAAACTAGAACAAAAATGG + Intergenic
1056600028 9:88039648-88039670 CTCTGCCCCTTTAAGATAAAAGG - Intergenic
1057320263 9:94006163-94006185 ATCTGAAACGTGGAGAAAAAGGG - Intergenic
1057320412 9:94007497-94007519 ATCTGAAACGTGGAGAAAAAGGG + Intergenic
1057429524 9:94980879-94980901 ATCTGAAACATGAAGGAAAAGGG - Intronic
1058264102 9:102875889-102875911 CTCTGAATTTTAAAGAAATATGG + Intergenic
1058354493 9:104067094-104067116 CTGAGGACTTTGAAGAAAAATGG - Intergenic
1059131417 9:111754867-111754889 CTCTGAACATTCAATAAAAAAGG - Intronic
1059724841 9:116997089-116997111 TTCTGAACTTGAAAGAAAAAAGG - Intronic
1060525386 9:124317532-124317554 CTCTGAATCTAAAATAAAAATGG - Intronic
1186330478 X:8527040-8527062 CTCTGATCTTTGATGAAGAATGG + Intergenic
1186919511 X:14262580-14262602 CTCAAAACCTTGACCAAAAATGG - Intergenic
1186951642 X:14632736-14632758 GTATGAACCATTAAGAAAAATGG - Intronic
1187012414 X:15293603-15293625 CTCTGAATCATGAACAAACATGG + Intronic
1188013821 X:25085881-25085903 ATTTGTACCTTCAAGAAAAACGG - Intergenic
1188440615 X:30212327-30212349 CTCTTAACTTTGGAGAAAACTGG + Intergenic
1188742546 X:33803665-33803687 CCCTAAACCTGGAAGTAAAAGGG - Intergenic
1189199387 X:39178730-39178752 CTTTTAAAATTGAAGAAAAATGG - Intergenic
1192450306 X:71240645-71240667 CTCTGAAGCATAAAGAAAACGGG + Exonic
1193000007 X:76553377-76553399 CTCTGGAAATTGAAGAAAAGAGG - Intergenic
1194074097 X:89367426-89367448 CTTTTAACCTTGAAAAGAAAAGG - Intergenic
1194187590 X:90792249-90792271 CTCAGAACTTTCTAGAAAAAGGG + Intergenic
1194909339 X:99620571-99620593 CACTGAAACTTGAAGACCAAGGG + Intergenic
1196030107 X:111087682-111087704 CTGTGGACGTGGAAGAAAAAGGG + Intronic
1196355722 X:114789598-114789620 CTCTGAAAATTAAAAAAAAAGGG + Intronic
1196721057 X:118854288-118854310 CTTTAAACCTTGAAAACAAAAGG - Intergenic
1197958255 X:131976430-131976452 CCCGGAACTTTGAAAAAAAAAGG - Intergenic
1198079188 X:133223131-133223153 CTCAGTACCTAGAAGAAGAAAGG + Intergenic
1199036096 X:143052790-143052812 CTCAGACCCTTGAGGAAACATGG - Intergenic
1199144209 X:144347087-144347109 CTCAGACCCTTCAAGAATAAAGG - Intergenic
1199317562 X:146399003-146399025 GTCCTAACCTGGAAGAAAAAGGG - Intergenic
1199426103 X:147702828-147702850 CTGAGAACCCTGAGGAAAAAGGG - Intergenic
1200534179 Y:4374203-4374225 CTCAGAACTTTCTAGAAAAAGGG + Intergenic
1200729489 Y:6718953-6718975 CTTTTAACCTTGAAAAGAAAAGG - Intergenic
1200882869 Y:8237673-8237695 CTCTGAATCTATAATAAAAATGG + Intergenic
1201396927 Y:13558755-13558777 CTCTGAAGCATCTAGAAAAAAGG + Intergenic
1201432748 Y:13921839-13921861 CTCTGATCTTTGATGAAGAATGG - Intergenic
1201852147 Y:18497141-18497163 CTTTGAACCTTTTAGAATAAAGG + Intergenic
1201881174 Y:18823239-18823261 CTTTGAACCTTTTAGAATAAAGG - Intronic
1202117581 Y:21486141-21486163 CTCTGAATCTATAATAAAAATGG - Intergenic
1202194689 Y:22287218-22287240 CTCTGAATCTATAATAAAAATGG + Intergenic
1202200190 Y:22339153-22339175 CTCTGAATCTATAATAAAAATGG - Intronic