ID: 1041506415

View in Genome Browser
Species Human (GRCh38)
Location 8:58603370-58603392
Sequence CTCCGCCACATGGTGCTCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041506411_1041506415 7 Left 1041506411 8:58603340-58603362 CCACTGCAGCATGTAGCTCTCAG 0: 1
1: 0
2: 2
3: 58
4: 327
Right 1041506415 8:58603370-58603392 CTCCGCCACATGGTGCTCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 133
1041506410_1041506415 15 Left 1041506410 8:58603332-58603354 CCACGCTGCCACTGCAGCATGTA 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1041506415 8:58603370-58603392 CTCCGCCACATGGTGCTCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041506415 Original CRISPR CTCCGCCACATGGTGCTCTG GGG Exonic
900430255 1:2597995-2598017 CCCCGCCACATCATACTCTGCGG + Intronic
902618419 1:17636559-17636581 CTGTGCCACAGGGTGCCCTGTGG + Intronic
902618959 1:17639475-17639497 CTCCTACACATGGTCCCCTGGGG - Intronic
904001039 1:27338939-27338961 CTCTGCCGCATGGTTCCCTGTGG - Intergenic
904488906 1:30846092-30846114 CTCCACCACCAGGTGCTGTGGGG + Intergenic
904915427 1:33966915-33966937 CTCCACCACCTGGTGCTTTATGG - Intronic
907300244 1:53482469-53482491 CTCTGCTACAGGGTACTCTGGGG + Intergenic
907862693 1:58368750-58368772 CTCTGTCTCATGGTTCTCTGGGG + Intronic
909775369 1:79478416-79478438 CTCCGCCACATGCTGCTGCAGGG - Intergenic
915661643 1:157410195-157410217 CTGCGCCCCAGGATGCTCTGTGG + Intergenic
916161880 1:161924914-161924936 TTCTGCAACATGTTGCTCTGTGG + Intronic
916563854 1:165956219-165956241 CTGCACCACATGGACCTCTGGGG - Intergenic
920251239 1:204623799-204623821 ATCCTACACTTGGTGCTCTGGGG - Intronic
921596907 1:217064504-217064526 CTTCTCTCCATGGTGCTCTGTGG - Intronic
923634599 1:235682413-235682435 GTCCGCCACATGCTTCTCTGGGG - Intronic
1062927057 10:1325131-1325153 CTGCTCCACATGCTGCTCAGGGG + Intronic
1064993089 10:21273590-21273612 CTCTGCCAAGTGTTGCTCTGTGG + Intergenic
1065938973 10:30546658-30546680 CACAGCCAAACGGTGCTCTGCGG + Intergenic
1065939488 10:30551245-30551267 CTCCTCAACATCGTTCTCTGGGG - Intergenic
1070393641 10:75992721-75992743 CTCCTCCCCATGGTGCTCCAGGG + Intronic
1070820070 10:79349234-79349256 CTCAGCCATTGGGTGCTCTGGGG + Intronic
1074615416 10:115062499-115062521 CTACTCCAGATGGTGGTCTGAGG - Intergenic
1075439654 10:122469584-122469606 CACTGCCACTGGGTGCTCTGTGG + Intronic
1075671827 10:124268222-124268244 CTCCCAGACCTGGTGCTCTGGGG - Intergenic
1076545887 10:131245620-131245642 CGCCGCCACATGTGGCTCTCTGG + Intronic
1076853421 10:133103952-133103974 CCCCGCCAGAGGCTGCTCTGTGG + Intronic
1076946961 10:133658162-133658184 CTCCTCCACATGGGGCCCTGAGG + Intergenic
1082856859 11:57816106-57816128 CTCAGCCACATGGGGCTCGAGGG + Intronic
1089045949 11:115502948-115502970 CTCCGCCACTTGTTGCTCCCGGG + Intronic
1090967828 11:131614056-131614078 CTCCGCCCCATGGTGCACCCAGG - Intronic
1091908203 12:4206482-4206504 CTCCGCCAAATGGTGTTCTATGG + Intergenic
1093093866 12:14950677-14950699 CTCCTCCACATGTGGCTCTGGGG + Exonic
1093176221 12:15916275-15916297 CACCATCACATGATGCTCTGAGG - Intronic
1094508598 12:31082421-31082443 CTCCCCCACCTGCAGCTCTGTGG - Intronic
1095991169 12:48035619-48035641 CTCCGCCTTCTAGTGCTCTGTGG + Intergenic
1098905095 12:76153744-76153766 CTCCTCCACATGGAGATCTCAGG + Intergenic
1102001516 12:109560784-109560806 CTTCACAACATGGTGCTCTGAGG + Intronic
1104802709 12:131565633-131565655 CTCAGCCACAAGGGGCTCAGAGG + Intergenic
1108944924 13:56010257-56010279 ATCTGTCACATGGAGCTCTGGGG - Intergenic
1113848024 13:113403543-113403565 CTCAGCCCCAGGGTGGTCTGGGG + Intergenic
1114139399 14:19893978-19894000 CTCCACCACATTGTATTCTGGGG - Intergenic
1114735274 14:25037209-25037231 CTCTGTCAAATGGGGCTCTGTGG - Intronic
1121097605 14:91228708-91228730 CTCAGCCACATGGGGATCTGCGG + Intergenic
1122393065 14:101403561-101403583 TCCGGCCACATGGAGCTCTGTGG - Intergenic
1202921033 14_KI270723v1_random:30711-30733 CTCCTGCACATGGGGCCCTGAGG + Intergenic
1202923881 14_KI270724v1_random:6863-6885 CTCCTCCACATGGGGCCCTGAGG - Intergenic
1125789619 15:42354221-42354243 CTCAGCCCCATGTTGCTCTCTGG - Exonic
1129054752 15:72811111-72811133 CTGGGCCACATGGTGCATTGAGG - Intergenic
1129650460 15:77483601-77483623 CTACCCCACACGGTGCTCAGTGG + Exonic
1131084922 15:89567957-89567979 CTCTGCCACAGGCTGCTGTGAGG - Intergenic
1135887893 16:26328976-26328998 CTCTGCCAGATGCTGCTATGGGG - Intergenic
1137817368 16:51411283-51411305 CTCTGCCCCAAGGTACTCTGAGG + Intergenic
1143961499 17:10724888-10724910 CTCCTCCACAGGGTACACTGGGG + Intronic
1145399713 17:22521502-22521524 CTGCGACATAGGGTGCTCTGGGG - Intergenic
1151351625 17:73535270-73535292 CTCTGCCACTTTGTGCTGTGTGG + Intronic
1151961802 17:77409552-77409574 CTCCGCCCCCTGCAGCTCTGTGG + Intronic
1155168148 18:23247650-23247672 CTCTGACACATGGTGCCCGGCGG - Intronic
1155206692 18:23564441-23564463 CCCAGCCACATGGTTATCTGAGG - Intronic
1156469439 18:37368240-37368262 TTCCTCCACATTGTGCTCAGAGG - Intronic
1157824125 18:50797260-50797282 CTCCTTCACATGGTGATCTCAGG + Intronic
1160007105 18:75075610-75075632 CTCCTGGACATGCTGCTCTGAGG + Intergenic
1160957696 19:1701305-1701327 CTCCCCCAGAAGGTGCCCTGGGG + Intergenic
1160981618 19:1818978-1819000 CTCTGCCACACGGTGCTTCGTGG - Intronic
1164037434 19:21467019-21467041 CTCCTCCACATGGGGCCCGGAGG - Intronic
1166544669 19:43626893-43626915 CTCCACCACAGGATTCTCTGGGG + Exonic
1167471931 19:49680265-49680287 CTCCCCTGGATGGTGCTCTGGGG + Intronic
927826064 2:26311059-26311081 CTCCCCCTCATGGTGCTCCTGGG - Exonic
928692343 2:33813471-33813493 CTACCTCACATTGTGCTCTGTGG - Intergenic
929881114 2:45838102-45838124 GACCACCCCATGGTGCTCTGAGG - Intronic
932104243 2:68928286-68928308 CGCTGCCTCATGGTGCTCTCAGG - Intergenic
932417578 2:71583232-71583254 CTCCAGCACCTGCTGCTCTGAGG + Intronic
934916150 2:98302611-98302633 CTCTACCTCATGGTGTTCTGAGG - Intronic
936280872 2:111138726-111138748 CTCCCCCACAGGCTGCTCTTGGG + Intronic
942298000 2:174535843-174535865 CTCGCCCACAGGGTGCTCTGTGG - Intergenic
946215910 2:218183530-218183552 CCCCGCCAGATGCTGCTGTGGGG - Intergenic
946275493 2:218628584-218628606 CTCCTTCACTTGGTACTCTGGGG + Intronic
948676262 2:239598603-239598625 CTCAGCCACGTGGAGGTCTGTGG + Intergenic
1169138929 20:3215478-3215500 CTCCCCCACACAGTGCTCTCTGG - Intronic
1169808113 20:9580281-9580303 CTCTGCCGCATGGTGGGCTGAGG + Exonic
1173706470 20:45114085-45114107 CTCCTCGACAAGGTGCTGTGAGG - Intronic
1174085423 20:48004605-48004627 CTCAGCCACATGTGGCACTGGGG + Intergenic
1175895051 20:62332466-62332488 CCCCGGCACAGGGTGCTGTGGGG + Exonic
1176326849 21:5508953-5508975 CTCCTCCACATGGGTCCCTGAGG + Intergenic
1176400908 21:6311998-6312020 CTCCTCCACATGGGTCCCTGAGG - Intergenic
1176436249 21:6677106-6677128 CTCCTCCACATGGGTCCCTGAGG + Intergenic
1176460511 21:7004176-7004198 CTCCTCCACATGGGTCCCTGAGG + Intergenic
1176484072 21:7385954-7385976 CTCCTCCACATGGGTCCCTGAGG + Intergenic
1178499778 21:33116087-33116109 CAGCTCCACATGGAGCTCTGCGG + Intergenic
1180197103 21:46203639-46203661 CTCGGCCATGTGCTGCTCTGCGG - Intronic
1180904049 22:19396087-19396109 CTCCCCAACAAGCTGCTCTGCGG + Intronic
1182699748 22:32226932-32226954 GTGAGCCCCATGGTGCTCTGGGG - Intronic
1183185397 22:36288889-36288911 CTCCTCCACCTGCTGCTCTAGGG + Exonic
1184549073 22:45194809-45194831 CTGAGCCACATGGTGCTGTCCGG - Intronic
1185224664 22:49645641-49645663 CTCTGCCACACGCTGCTCTCTGG - Intronic
952813215 3:37423664-37423686 CTTTCCCACATGGTGCTCTCAGG - Intronic
953831020 3:46297625-46297647 CTACCCCACATGGCACTCTGGGG - Intergenic
954874528 3:53792997-53793019 CTGCACCACATGGTGATGTGGGG + Intronic
956840491 3:73135464-73135486 CTCCTCCACATGGGGGTTTGGGG - Intergenic
957080499 3:75632254-75632276 CTCCTCCACATGCGGCCCTGAGG - Intergenic
958905177 3:99934107-99934129 CTTCCCCACATGGTGGTCTCAGG + Intronic
963781565 3:149491870-149491892 TTCTGCCACACAGTGCTCTGAGG - Intronic
965609263 3:170527323-170527345 CTCTGCCACTTACTGCTCTGTGG + Intronic
967940294 3:194761209-194761231 CTCCACCACAGGGTCCTCTTGGG + Intergenic
968769785 4:2497481-2497503 CTCCAACACAGGGAGCTCTGTGG - Intronic
980742767 4:136973608-136973630 CCCCAGAACATGGTGCTCTGGGG - Intergenic
982219687 4:153113913-153113935 CCAGGCCACTTGGTGCTCTGTGG + Intergenic
985450419 4:190058961-190058983 CTCCTCCACATGGGGCCCTGAGG + Intergenic
987035315 5:14013294-14013316 CCCCGCCTCATGGAGATCTGGGG - Intergenic
989581111 5:43034137-43034159 CCCCGCCTCAAGGTGCTCTGAGG - Intergenic
989659534 5:43785349-43785371 CTCTGCCACATAGTGTTCTCTGG + Intergenic
992470308 5:77045137-77045159 ATTCGCCTCATGTTGCTCTGAGG + Intronic
999736110 5:154514585-154514607 CTCCTCCACCTGGTGCTCCAGGG + Intergenic
1000273153 5:159706081-159706103 CTCCTCCACATGGTGTTATCTGG + Intergenic
1010099353 6:72085626-72085648 CTCTGCCACATGGTGGTCTCTGG + Intronic
1014643679 6:123946824-123946846 CTCTGCCACATGGGGGCCTGTGG + Intronic
1018768075 6:166949764-166949786 CTGCACCACACGGGGCTCTGAGG + Intronic
1022482217 7:30751807-30751829 GGCAGCCACATGCTGCTCTGTGG - Intronic
1023829786 7:44032189-44032211 CTCTGCCACACTGGGCTCTGGGG + Intergenic
1024981210 7:55159091-55159113 CTCCTCCACAAGGTGCACTCTGG + Intronic
1029740098 7:102486448-102486470 CTCTGCCACACTGGGCTCTGGGG + Intronic
1029758095 7:102585627-102585649 CTCTGCCACACTGGGCTCTGGGG + Intronic
1029776033 7:102684688-102684710 CTCTGCCACACTGGGCTCTGGGG + Intergenic
1032174485 7:129612106-129612128 CTCCGCCGCCTGGGGCTCTCGGG + Intronic
1034780237 7:153872716-153872738 CTCTGCCACTTAGTGCTGTGGGG - Intergenic
1035262178 7:157669100-157669122 CACCGCTACAAGGTGCTCCGGGG + Intronic
1035888999 8:3324076-3324098 CTCCCCCACCTGGGTCTCTGGGG - Intronic
1037766806 8:21777299-21777321 GTCCGCCAGATGGTGCCCCGGGG + Intronic
1038326479 8:26576799-26576821 CTCCGCCCCACGGTGCGGTGTGG + Intronic
1039982184 8:42417011-42417033 CACCGCCACACACTGCTCTGGGG + Exonic
1041184327 8:55283354-55283376 CTCCGTCACCAGCTGCTCTGTGG + Intronic
1041474536 8:58249042-58249064 CCCAGCCACATGCTGCACTGTGG - Intergenic
1041506415 8:58603370-58603392 CTCCGCCACATGGTGCTCTGGGG + Exonic
1048593695 8:135844837-135844859 CTCAGACTCATAGTGCTCTGAGG - Intergenic
1053221287 9:36315452-36315474 CTCCTGCACATGGAGCTCTGAGG - Intergenic
1055348985 9:75365623-75365645 CTCTGTCCCAGGGTGCTCTGGGG + Intergenic
1056873523 9:90306249-90306271 CTAAGCCCCATGCTGCTCTGGGG + Intergenic
1058654974 9:107211964-107211986 TTCTGCCTCATGGTGCTCAGTGG - Intergenic
1060589008 9:124804175-124804197 CTCAGCCTCATCCTGCTCTGCGG - Exonic
1060858498 9:126934611-126934633 CTTCACCACATGAAGCTCTGGGG + Intronic
1061632752 9:131883520-131883542 CTTCCCCACTTTGTGCTCTGGGG - Intronic
1062194866 9:135267295-135267317 CTCTGCCACCGGGTCCTCTGGGG + Intergenic
1203435266 Un_GL000195v1:131555-131577 CTCCTCCACATGGGTCCCTGAGG - Intergenic
1189237132 X:39495777-39495799 CTGCTGCACATAGTGCTCTGTGG + Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1190938135 X:55014895-55014917 CTGCCCCCCATGGTGCTCTCTGG - Exonic
1200142502 X:153909076-153909098 CACCTCCACGTGTTGCTCTGGGG + Exonic