ID: 1041507350

View in Genome Browser
Species Human (GRCh38)
Location 8:58614285-58614307
Sequence TCCCTATGTTAAAGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 2, 2: 22, 3: 46, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041507350_1041507352 8 Left 1041507350 8:58614285-58614307 CCAGCACTCCTTTAACATAGGGA 0: 1
1: 2
2: 22
3: 46
4: 128
Right 1041507352 8:58614316-58614338 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041507350 Original CRISPR TCCCTATGTTAAAGGAGTGC TGG (reversed) Intronic
901198752 1:7454816-7454838 TCCCTGTGTTAAAGGAAGGTTGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
907162106 1:52378399-52378421 TCCCAAAGTTAAAGGATTACAGG - Intronic
909742376 1:79045833-79045855 TCCTTATGATACGGGAGTGCTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912729553 1:112090139-112090161 GTCCTTTGTTACAGGAGTGCTGG - Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
922609401 1:226913340-226913362 TGTCTATGTTAAATGACTGCAGG - Intronic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1070138409 10:73716066-73716088 ACCATATGCTAAAGGAGTGTTGG - Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1085886457 11:80528375-80528397 TCCCATTGTTAAAAGTGTGCAGG - Intergenic
1086894634 11:92297741-92297763 TCCAGATGTCAAAGGAGTGGGGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1094638655 12:32251673-32251695 TCCCTGTGTTAATGGAGTCTTGG + Intronic
1095822481 12:46493625-46493647 TCCCTCTGTAAAAGGATTGTGGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1102806136 12:115782523-115782545 TCCCTATGTGAAATGTGTGTTGG - Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1106940173 13:34769548-34769570 TCCCTATGGTATATGAGTCCTGG + Intergenic
1107521393 13:41185591-41185613 TCTCTGTGTTAAAGGTATGCAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108517881 13:51220291-51220313 TCCCCATCTTAAAGGGGTGGAGG + Intergenic
1109270018 13:60245510-60245532 TCCCTATGTGAAGGGAGTAGTGG + Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116885241 14:50214426-50214448 TGGCTGTGTTAAAGAAGTGCAGG - Intronic
1117028945 14:51650802-51650824 GCCCTTCGCTAAAGGAGTGCCGG - Intronic
1117477966 14:56116914-56116936 TCCCTTTAGTGAAGGAGTGCTGG + Intergenic
1117513321 14:56474252-56474274 GCCCTATGTTCAATGAGAGCTGG + Intergenic
1118647035 14:67850641-67850663 TTCCTATTTTACGGGAGTGCTGG + Intronic
1118684785 14:68280627-68280649 ACCCTATTCTAAAGGAGTGAAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121218425 14:92266311-92266333 TCCTTTTGTTAAAGGATTTCAGG + Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123196000 14:106617297-106617319 TCTCTATTTTAAAGGAATACTGG - Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1125867041 15:43061935-43061957 TCCCTAGGTTATTGGAGTACAGG - Intronic
1126745114 15:51818024-51818046 TCCATGTGATACAGGAGTGCTGG - Intergenic
1128162330 15:65431805-65431827 TCCCTAAGAGAAAGCAGTGCAGG - Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1135589500 16:23695016-23695038 TACCTATGTGTAAAGAGTGCAGG + Exonic
1135881379 16:26260954-26260976 TCCCAATGTGCAAGGATTGCAGG - Intergenic
1139344072 16:66290672-66290694 TCCCTTAGTAAAAGCAGTGCAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1145736262 17:27233939-27233961 TCACTAAGTTAAAGCAGAGCTGG - Intergenic
1151293487 17:73166431-73166453 CCCCTATGTAAAAGGGGGGCGGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1153505425 18:5791646-5791668 TCCCTATGCACAAGGGGTGCTGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164062036 19:21683936-21683958 TCCTGAGGTTAAAGGAGTTCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165971194 19:39631719-39631741 TCTCTATTTTAAAGAAGAGCAGG - Intergenic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
926174274 2:10575095-10575117 TCCCTCTGTGACAGGAGTGCTGG - Intronic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
930303003 2:49640520-49640542 TCCCTACTTTAAAGGAGGGCTGG + Intergenic
931556707 2:63513943-63513965 GTCCTTTGTTAAAGGAGTGTTGG + Intronic
931992413 2:67803713-67803735 ACCATAGGTGAAAGGAGTGCAGG - Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
936450686 2:112631881-112631903 TGGGTATGTTAAAGGAGTGAAGG - Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
940223851 2:151381898-151381920 TGCCTTTGTTATAGGAGTGTTGG + Intergenic
940544730 2:155069566-155069588 TTCCTATGTTAATTGATTGCTGG + Intergenic
941246381 2:163102663-163102685 TCCCTACGTTAGAGGGGTGTGGG + Intergenic
941918363 2:170826891-170826913 TCCCTCTGGCAAATGAGTGCTGG + Intronic
942903839 2:181157068-181157090 TCCCAATGTTGAAGGAGGCCTGG - Intergenic
944360516 2:198850183-198850205 TCCATATGTTATTGGAGTACAGG - Intergenic
944386088 2:199166322-199166344 TCACTCTGTTAAACAAGTGCTGG - Intergenic
945756220 2:213850295-213850317 TGCCTTTGTTATAGTAGTGCTGG - Intronic
946161623 2:217839285-217839307 ACCCTATGTTCAAGGAGCCCTGG + Intronic
946192469 2:218014834-218014856 TCAGTAAGTTAAAGGATTGCAGG + Intergenic
946777222 2:223155772-223155794 TCCCTATTATTTAGGAGTGCTGG - Intronic
946820243 2:223621410-223621432 CCCCTATCTTAGAGGAGTGCTGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1168941949 20:1720295-1720317 TACCTATGTTCAAGGGATGCAGG + Intergenic
1173505712 20:43585519-43585541 GCCCTCTGGTAAAAGAGTGCTGG - Exonic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174539469 20:51277570-51277592 CCCCTATGTTAAAGCAGGGGAGG - Intergenic
1174938312 20:54896357-54896379 TCCATAAGTTATTGGAGTGCAGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177346558 21:19879975-19879997 TCCATATGTTACAGGAATGGGGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1185399123 22:50606876-50606898 TCCCTGTGTCAAAGGAGGCCTGG - Intronic
955394315 3:58546580-58546602 TTCCTATCTTAAAGGGATGCTGG + Intergenic
957163099 3:76635450-76635472 TGCCTATGTCATAGGAATGCCGG + Intronic
958120273 3:89278095-89278117 ACTCTATTTTAAAGGACTGCTGG - Intronic
958421108 3:93932814-93932836 ACCCTCTGTTCAAGGAGGGCAGG + Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
960566239 3:119134969-119134991 TCCCTATTTAAAAGTGGTGCTGG + Intronic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
963856633 3:150260492-150260514 TCCCTATGGTAAAGTGCTGCTGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966094347 3:176180732-176180754 TCCATATGTTATTGGAGTACAGG + Intergenic
967678957 3:192337215-192337237 TCCCTATGTTACAGAAGTTCAGG + Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
973829489 4:54743892-54743914 TCCCACTTTTAAAGGGGTGCTGG - Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975795488 4:78002560-78002582 TCTCTATTTTAAAGAAGAGCAGG + Intergenic
975923888 4:79425755-79425777 TCACTATGGAAAAGCAGTGCTGG - Intergenic
977271324 4:94920576-94920598 GCCCCATGTTAAAGGACTGTGGG + Intronic
977945651 4:102911028-102911050 TGCCTTTGTCAAAGGAGAGCAGG + Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
978647223 4:110950176-110950198 TCCCTATATTAAATGAGAGTTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982105495 4:152008468-152008490 TCCGTTGGTTAAAGGATTGCAGG - Intergenic
982228535 4:153187508-153187530 TCCGCAGGTTAGAGGAGTGCAGG + Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
986807856 5:11325840-11325862 CTCCTATGTTGAAGGAATGCTGG - Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
987772971 5:22330448-22330470 TCCCTATATTAAAGAAAAGCAGG + Intronic
988316275 5:29633676-29633698 TCCATATGCTAAAGAACTGCAGG - Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
990253454 5:53941267-53941289 TCCTTTTTTTAAAGGATTGCAGG - Intronic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
993995539 5:94718268-94718290 TCCCTATATAAAAACAGTGCTGG + Intronic
998098702 5:139413853-139413875 TGCCTATGTGAATGGAGTTCAGG - Exonic
998776262 5:145606840-145606862 ACCAGATGTAAAAGGAGTGCTGG - Intronic
999680799 5:154058309-154058331 TCCCTATGGCAAAAGATTGCTGG + Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007663160 6:43498787-43498809 CCCATAGGTCAAAGGAGTGCTGG - Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1017979183 6:159384150-159384172 TCACTATTTTACAGGAGTACAGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023287723 7:38636715-38636737 TCCTTGTGTTCAAGGAGGGCGGG - Intergenic
1024024366 7:45398822-45398844 TCCCTATTTTAAAGGTGAGGAGG + Intergenic
1024051298 7:45625048-45625070 TTCCTTTGATAAAGAAGTGCTGG + Intronic
1024264388 7:47595684-47595706 TCACTGTGATACAGGAGTGCTGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1025192983 7:56910553-56910575 TATCTATGTTTTAGGAGTGCAGG + Intergenic
1025678962 7:63666367-63666389 TATCTATGTTTTAGGAGTGCAGG - Intergenic
1025752715 7:64307305-64307327 TCCCTAGGTTGCAGGACTGCAGG - Intergenic
1031628781 7:124021270-124021292 TCCATCTGATAATGGAGTGCTGG - Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1037331372 8:17747142-17747164 TCCATATGCAAAAGGATTGCTGG - Intronic
1037560164 8:20066194-20066216 GCCCCATGTGAAAGGAGTGATGG - Intergenic
1039304369 8:36245417-36245439 TACCTATATTAAAAGAGTGGTGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039628219 8:39078483-39078505 TCCCTATTTTAAATTAGGGCTGG + Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042677799 8:71341727-71341749 TCTTTATCTTAAAGGAGGGCAGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048207553 8:132427373-132427395 TCCTTACGTTAAAGGAGACCAGG - Intronic
1049174794 8:141185245-141185267 TGCCCACTTTAAAGGAGTGCTGG - Exonic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055462634 9:76533147-76533169 TTCTTATGTTAAAGGAGTAACGG - Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1192780920 X:74293172-74293194 TCCCATTGTGAAAGGAATGCGGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194740448 X:97566590-97566612 TCCCTATGTGAAACGTGTGCAGG - Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic