ID: 1041513619

View in Genome Browser
Species Human (GRCh38)
Location 8:58676598-58676620
Sequence TCATATCCCGACGGGGCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041513614_1041513619 -6 Left 1041513614 8:58676581-58676603 CCTGGCAGAGACGCTCCTCATAT No data
Right 1041513619 8:58676598-58676620 TCATATCCCGACGGGGCGACAGG No data
1041513612_1041513619 16 Left 1041513612 8:58676559-58676581 CCTCACTTCTCAGACGGGGCGGC 0: 1343
1: 2046
2: 5102
3: 9439
4: 6078
Right 1041513619 8:58676598-58676620 TCATATCCCGACGGGGCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041513619 Original CRISPR TCATATCCCGACGGGGCGAC AGG Intergenic
No off target data available for this crispr