ID: 1041519887

View in Genome Browser
Species Human (GRCh38)
Location 8:58744123-58744145
Sequence CTAGTTCTGCTGTGCAACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041519883_1041519887 27 Left 1041519883 8:58744073-58744095 CCATATATAGTAAACTACTTAGT No data
Right 1041519887 8:58744123-58744145 CTAGTTCTGCTGTGCAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041519887 Original CRISPR CTAGTTCTGCTGTGCAACAT AGG Intergenic
No off target data available for this crispr