ID: 1041520925

View in Genome Browser
Species Human (GRCh38)
Location 8:58755539-58755561
Sequence CTTTGTAAGGCCAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041520925_1041520932 -8 Left 1041520925 8:58755539-58755561 CCTCCCACCTTGGCCTTACAAAG No data
Right 1041520932 8:58755554-58755576 TTACAAAGTGTTGGGATTACAGG 0: 5
1: 1345
2: 37232
3: 340340
4: 254089

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041520925 Original CRISPR CTTTGTAAGGCCAAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr