ID: 1041523463

View in Genome Browser
Species Human (GRCh38)
Location 8:58779736-58779758
Sequence AGGTGGAGATGAAGAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041523463_1041523464 -7 Left 1041523463 8:58779736-58779758 CCTACTTCTCTTCATCTCCACCT No data
Right 1041523464 8:58779752-58779774 TCCACCTCCTTCATGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041523463 Original CRISPR AGGTGGAGATGAAGAGAAGT AGG (reversed) Intergenic
No off target data available for this crispr