ID: 1041524384

View in Genome Browser
Species Human (GRCh38)
Location 8:58789179-58789201
Sequence CTGTGGAACAAGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041524379_1041524384 -9 Left 1041524379 8:58789165-58789187 CCTGGGATCAACACCTGTGGAAC No data
Right 1041524384 8:58789179-58789201 CTGTGGAACAAGAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041524384 Original CRISPR CTGTGGAACAAGAGGGAAGG AGG Intergenic
No off target data available for this crispr