ID: 1041527262

View in Genome Browser
Species Human (GRCh38)
Location 8:58821296-58821318
Sequence TAGTAGGTATAGAAAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041527262 Original CRISPR TAGTAGGTATAGAAAGGAGG GGG (reversed) Intronic
903623606 1:24715460-24715482 TAGCAGGCATGGAGAGGAGGGGG - Intergenic
904311332 1:29631555-29631577 AAGGAGGGAGAGAAAGGAGGGGG + Intergenic
904685036 1:32253588-32253610 TAGTAGGTGTTTAAGGGAGGTGG + Intronic
905328378 1:37174665-37174687 TAGTAAGTATATGGAGGAGGAGG - Intergenic
905598172 1:39226730-39226752 TAGTAAGTATTTAAAGGAGGTGG - Intronic
907866897 1:58407294-58407316 TAGTAGAGATAGAAAAGGGGTGG - Intronic
908754846 1:67460119-67460141 CAGTGGTTATAGAAAGGAGGTGG - Intergenic
909856035 1:80533167-80533189 TTGGAGGTATAGGGAGGAGGGGG - Intergenic
910248978 1:85173708-85173730 TACGAGGCATATAAAGGAGGAGG + Intronic
910636016 1:89408750-89408772 TAGTAGGAGTGGAGAGGAGGAGG - Intergenic
911006741 1:93233957-93233979 TAGTAGGCATAGCAAGCAGTAGG - Intronic
912375370 1:109205283-109205305 TGGTAGATATAGAAAGGGGATGG + Intronic
912466759 1:109879955-109879977 AAGTAGGTAAAGGAATGAGGGGG + Intergenic
912605582 1:110985582-110985604 CAGCAGGTATGGAAATGAGGAGG + Intergenic
912812691 1:112805838-112805860 TGGTGGGAATAGAAAGGAGCTGG - Intergenic
913376338 1:118156749-118156771 TAGTAGGTTGAGAAAGGAAGAGG - Intronic
918402392 1:184176521-184176543 AGGTAGGTAAAGAAAGGAGTTGG - Intergenic
919969147 1:202561450-202561472 TGGTAAGTATAGAGAGGAGGAGG + Intronic
920987549 1:210904679-210904701 GGGTAGGAATAGAAAGGAAGAGG + Intronic
923784682 1:237055497-237055519 TTGTGGGAATAGAAAGGAGCGGG + Intronic
1063800909 10:9576494-9576516 GAGTATGTATACAATGGAGGTGG + Intergenic
1064713038 10:18145966-18145988 TAGCAGGTACAGGAGGGAGGAGG - Intronic
1066316025 10:34247150-34247172 TATTAGACATAGAAAGGAAGAGG + Intronic
1066636081 10:37502448-37502470 TAATAGGTATAGAAATGATATGG - Intergenic
1067530208 10:47065523-47065545 TAGCAGGCATGGAGAGGAGGGGG + Intergenic
1067961967 10:50864411-50864433 TAGAAGGGATATAAAGGAGAAGG - Intronic
1068661713 10:59629437-59629459 TGATAGGTACAGAAGGGAGGGGG + Intergenic
1069279437 10:66636444-66636466 TAGTAGTTCTAGAAGGGAGGAGG + Intronic
1072172180 10:92875265-92875287 GAATTGGTAGAGAAAGGAGGAGG - Intronic
1072353531 10:94582050-94582072 TAGTAGCTTCAGAATGGAGGAGG + Intronic
1073308002 10:102518331-102518353 CAGGAGGTAGAAAAAGGAGGTGG - Intronic
1074943402 10:118256785-118256807 TTGTAAGTATAGACAGGAGAGGG - Intergenic
1075019470 10:118940523-118940545 GAGTATGTATAGAAAGGAGGAGG + Intergenic
1078197987 11:9152654-9152676 TACTGGGAATAGAAAGGAGATGG + Intronic
1078482646 11:11691992-11692014 TAGTAGGTAAACAAAGCAGCTGG + Intergenic
1078955768 11:16193197-16193219 TATTAGAGATAGAAAGGATGTGG - Intronic
1079109196 11:17594643-17594665 TAGCAGAGATAGAAATGAGGGGG + Intronic
1082762095 11:57136916-57136938 GAGGAGGAATAGGAAGGAGGAGG + Intergenic
1085520026 11:77132249-77132271 AGGTAGGCAGAGAAAGGAGGAGG - Intronic
1085591165 11:77762403-77762425 CACTAGGGATGGAAAGGAGGGGG - Intronic
1086190839 11:84076933-84076955 TAATAGGAATAGAAAGGAGACGG - Intronic
1086567260 11:88240959-88240981 GAGTAGGTAAAGAAAGCAGCTGG + Intergenic
1090955748 11:131511727-131511749 CAGTATGCACAGAAAGGAGGTGG - Intronic
1091508979 12:1102188-1102210 TATTAGGTTTAGAAACAAGGAGG + Intronic
1092924321 12:13259769-13259791 GGGTAGGTAAAGGAAGGAGGGGG + Intergenic
1093025412 12:14241019-14241041 TAGTAGGGATCGTAAGGAGATGG - Intergenic
1093602888 12:21051982-21052004 TAGAAGGGAAATAAAGGAGGAGG - Intronic
1096179565 12:49543171-49543193 ATGCAGGGATAGAAAGGAGGTGG + Intronic
1097286323 12:57879997-57880019 TAGGAGGAATAAAAAGCAGGAGG - Intergenic
1097931363 12:65190490-65190512 TATGATGTATAGAAAGGAAGGGG - Intronic
1099018238 12:77371297-77371319 AAGCAGGAATATAAAGGAGGTGG + Intergenic
1099408229 12:82289642-82289664 AAGTAGGTATGAAGAGGAGGAGG - Intronic
1099648295 12:85389636-85389658 CAGTAAGAATAGAAAGGAAGAGG - Intergenic
1099717827 12:86319119-86319141 CAGTAGGAGTAGAAAGGAGTAGG - Intronic
1099771761 12:87068823-87068845 TAATAGGTGTACAAAGGTGGTGG + Intergenic
1099800191 12:87447486-87447508 TGGCATGTATAGAAAGAAGGGGG + Intergenic
1100106611 12:91182735-91182757 TTGCAGGTGTGGAAAGGAGGAGG + Exonic
1101095030 12:101329639-101329661 TACTAGGCATACAAAGAAGGAGG + Intronic
1101721921 12:107357975-107357997 AAGGAGGGAAAGAAAGGAGGAGG - Intronic
1104549035 12:129739139-129739161 TAGGCGGTATAGTGAGGAGGTGG + Intronic
1108723138 13:53152229-53152251 GAGTGGGGATGGAAAGGAGGGGG + Intergenic
1109432408 13:62252617-62252639 TACTAGGCAGAGAAAGAAGGAGG - Intergenic
1110706825 13:78607340-78607362 TAGTGGGTATACAGGGGAGGGGG + Intergenic
1113346809 13:109486190-109486212 CAGGAGGAATAGAAAGCAGGGGG - Intergenic
1115006953 14:28497591-28497613 TAGTAAGTATATAAATGAGCTGG + Intergenic
1115206426 14:30910774-30910796 TAGTAGTTACAAAAAGAAGGAGG - Intronic
1116105808 14:40503480-40503502 TAGTAGGAATAGGCAGAAGGGGG + Intergenic
1116741448 14:48760381-48760403 TGGTAAGTATAGGGAGGAGGGGG - Intergenic
1117018107 14:51539699-51539721 TAGTAGAGAGAGAAAGGTGGGGG - Intronic
1117022091 14:51581241-51581263 TAGTAGATAAAGAAAGATGGGGG - Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1119658682 14:76435530-76435552 TAATAGTTATGGAAATGAGGCGG + Intronic
1120584540 14:86295513-86295535 TAGTGGGCATAGGAAGGTGGTGG + Intergenic
1121954942 14:98205190-98205212 TTGTACTTAGAGAAAGGAGGCGG - Intergenic
1122614018 14:103004409-103004431 TAGTGGGTATAGGACGGAGAGGG - Intronic
1124990996 15:34673745-34673767 TAGTAGGGGTAGAAAGGAGTGGG - Intergenic
1126237980 15:46407854-46407876 ATGTAGGAATAGAAAGAAGGAGG - Intergenic
1128671378 15:69576892-69576914 GGGTAGGGATAGGAAGGAGGAGG + Intergenic
1133469982 16:6065702-6065724 TAGTAGGTCTACAGAGGAAGGGG - Intronic
1134655152 16:15942558-15942580 TAGTGGGGAAAGAAAGGAAGTGG + Intergenic
1137877984 16:52015487-52015509 TAGTAGGGAAAAGAAGGAGGGGG + Intronic
1138936749 16:61735772-61735794 CTTTAGGTATAGAAAGGTGGAGG + Intronic
1138951305 16:61916685-61916707 TAATAGATATGGAAAGGAGAGGG + Intronic
1139946319 16:70644867-70644889 AAGTAGGAAGAGGAAGGAGGTGG + Intronic
1141222930 16:82088667-82088689 TATTAGTAATAGAAAGGAGTTGG + Intronic
1141342062 16:83212585-83212607 AAATAGGTCTAGAAAGAAGGTGG + Intronic
1142176604 16:88648168-88648190 CAGTAGGTAGAGAAGGGGGGTGG - Intronic
1144878111 17:18413011-18413033 TTGGAGGTATAAAAAGGAGATGG - Intergenic
1145911218 17:28544337-28544359 GAGAAGGTATAGCAAGGAAGAGG - Intronic
1145970889 17:28955849-28955871 TAGGTGGTATATACAGGAGGTGG + Exonic
1147910820 17:43854943-43854965 TCCAAGGTATAGAAAGGTGGTGG + Intronic
1149134688 17:53350452-53350474 TTGTAGGTATAGAGAGGTTGGGG + Intergenic
1149225506 17:54465570-54465592 GAGTAGGTAAACAAAGGAGCTGG - Intergenic
1151080343 17:71322414-71322436 TAGTCGGAAAAGAAATGAGGTGG - Intergenic
1151363859 17:73604726-73604748 ATGTGGGTATAGAAATGAGGAGG + Intronic
1151955789 17:77379563-77379585 TGGGAGGTGGAGAAAGGAGGAGG - Intronic
1153959619 18:10129976-10129998 TTGTAGTTATAGAATGGAGTTGG + Intergenic
1154444967 18:14428578-14428600 CAGTAGGTAAAGAAAGCAGCCGG - Intergenic
1158038266 18:53061306-53061328 GAGTAGGAATAGAAAGGATTAGG - Intronic
1158440142 18:57468098-57468120 TAGAAGGGAGTGAAAGGAGGAGG + Intronic
1159246763 18:65815848-65815870 GAGTAGGCATAGAAGGGAAGAGG - Intronic
1159560314 18:69985984-69986006 TAGGATGGATAGAAAGGAGCCGG - Intergenic
1159733812 18:72067731-72067753 TAGTAGGTGCTGGAAGGAGGCGG - Intergenic
1159974533 18:74694074-74694096 TAGTAGTTATTGACTGGAGGTGG + Intronic
1163779542 19:19239355-19239377 TAGGAGGGAAAGGAAGGAGGAGG - Intronic
1166169115 19:41014853-41014875 GAGTAGGAAAAGGAAGGAGGAGG + Intronic
1168392556 19:56022392-56022414 TATTTGTTATAGAAAGGAGGGGG + Intronic
1168487236 19:56774233-56774255 TGGAAGATATAGAAAGGAAGTGG + Intergenic
926121932 2:10245949-10245971 TGGTAGGTTTGGAGAGGAGGAGG + Intergenic
926643846 2:15266742-15266764 AAGTAGGTAGAGAAGGAAGGAGG - Intronic
927108538 2:19847863-19847885 TAGTAGGTAAAGGTAGGAGGTGG + Intergenic
929005643 2:37390414-37390436 GAGTAGGCAGAGGAAGGAGGGGG + Intergenic
929289042 2:40168335-40168357 TGGTAAGGATAGATAGGAGGTGG + Intronic
930055287 2:47247272-47247294 TATTAGGTATACAAAGGGGAGGG - Intergenic
930348293 2:50215174-50215196 GAGTAGGATTAGAATGGAGGTGG - Intronic
930517644 2:52428558-52428580 TAGAAGATATAGAGGGGAGGAGG + Intergenic
931462769 2:62462807-62462829 GAAAAGGTAGAGAAAGGAGGAGG - Intergenic
931795153 2:65701252-65701274 TAGTTTGTGTAGAAAGGAAGTGG + Intergenic
933136727 2:78745453-78745475 TTTTAGATATAGAAAGAAGGTGG - Intergenic
933382478 2:81567008-81567030 AAGTAGGAAGAGAAAGAAGGAGG - Intergenic
933999612 2:87696850-87696872 TAGTAACTCCAGAAAGGAGGAGG - Intergenic
936558780 2:113518577-113518599 TAGTGGGCATGGAAGGGAGGGGG + Intergenic
937229261 2:120387994-120388016 TAGGAGGTCTAGGAAGGAGCAGG + Intergenic
937230100 2:120393361-120393383 ATGTGGGTATAGGAAGGAGGAGG - Intergenic
937871449 2:126789174-126789196 GACCAGGGATAGAAAGGAGGAGG - Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
941238523 2:163007509-163007531 TACTAGGTATAGGAAGAAGTCGG - Intergenic
941269210 2:163404437-163404459 TAGCAGCTATAGAAATGATGTGG + Intergenic
942051858 2:172147513-172147535 TTGAAGGTATAGAAAGAATGGGG + Intergenic
943798548 2:192029127-192029149 TGGTAGGTAGAGAATGGACGTGG - Intronic
944793325 2:203155783-203155805 AAGTTGGTATAAAAAGTAGGAGG - Intronic
946115239 2:217455570-217455592 TCTTAGGTATAGAAAGGAGGAGG + Intronic
946897918 2:224343634-224343656 TATTAGGTCTAGCAAGGAGAGGG - Intergenic
1168743144 20:212126-212148 CTGTAGGTAGAGAAAGAAGGAGG + Intergenic
1168994347 20:2121645-2121667 GAGTGGGTATAGACAAGAGGAGG + Intronic
1170308895 20:14971436-14971458 TAGTAGGTAAAGGGAGGGGGGGG + Intronic
1170331204 20:15212880-15212902 TAGTAGGTCTGGAATGGAGTAGG - Intronic
1170658015 20:18308489-18308511 TATTAGGTATAGAAAGGTTCAGG + Intronic
1170684164 20:18553984-18554006 TAGTTGATATAGAAGAGAGGAGG + Intronic
1171273650 20:23835904-23835926 GAGTAGGTAAAGAAAGCAGTCGG + Intergenic
1172381165 20:34493507-34493529 AAGTAGAAATAGAAAAGAGGGGG + Intronic
1172428846 20:34874201-34874223 TAGCAACTATAGACAGGAGGGGG + Intronic
1172956074 20:38760188-38760210 CAGTAGGTAGCAAAAGGAGGAGG + Intronic
1173948738 20:46973320-46973342 GAGTCTGTATAAAAAGGAGGGGG + Intronic
1174672692 20:52322799-52322821 TTGGAGGCATAGCAAGGAGGTGG + Intergenic
1175148055 20:56911529-56911551 TAGTCGCTATAGAAAGCAGCTGG - Intergenic
1175988674 20:62776938-62776960 CAACAGGTACAGAAAGGAGGGGG + Intergenic
1176829188 21:13726342-13726364 CAGTAGGTAAAGAAAGCAGCCGG + Intergenic
1177865612 21:26509505-26509527 TAGCAGCTGTAGAAAGGATGTGG + Intronic
1178159195 21:29892305-29892327 TAGGAGGTAAAGGAAGGAGGTGG + Intronic
1179129207 21:38619371-38619393 TAAGAGGAATAGAGAGGAGGAGG - Intronic
1179165226 21:38930308-38930330 TTCTTGGTAGAGAAAGGAGGGGG + Intergenic
1181393817 22:22603832-22603854 TGGGAGGTAGAGAAAGGAGGGGG + Intergenic
1182834984 22:33334615-33334637 TAGAAAGCACAGAAAGGAGGTGG + Intronic
949333992 3:2953487-2953509 TAGAAGTTGTAGAATGGAGGAGG - Intronic
950654507 3:14428196-14428218 CAGTTGGAATAGAAGGGAGGGGG + Intronic
952216664 3:31284863-31284885 TACTAGTCATAGAATGGAGGAGG - Intergenic
955814097 3:62823643-62823665 TGGGAGGTAGAAAAAGGAGGTGG - Intronic
956861458 3:73327924-73327946 TTGTAGAAATAGAGAGGAGGAGG - Intergenic
957661191 3:83155763-83155785 TAGAAGGTATAAAAAAGAGTGGG - Intergenic
958164641 3:89864262-89864284 TAGTAGGTTTGGAAAGAAGTAGG - Intergenic
958962554 3:100523763-100523785 GAGAAGGAAGAGAAAGGAGGAGG - Intronic
959401753 3:105911132-105911154 AAGTAGGTTTAGAGAGGAAGAGG + Intergenic
959482839 3:106894488-106894510 TAGTATGTACAGAAAGTAGAGGG + Intergenic
959737135 3:109672387-109672409 TGGTAGGCCTAGACAGGAGGGGG - Intergenic
962522789 3:136212603-136212625 AGGTAGGAAGAGAAAGGAGGTGG + Intergenic
963299278 3:143580908-143580930 TAATAGGTATAGGAAGTGGGAGG + Intronic
963562723 3:146886392-146886414 TAAGAGGAATAGAAAGGGGGAGG + Intergenic
963711853 3:148755437-148755459 GAGGAGGAATAGAAAGGAGGAGG - Intergenic
964092856 3:152896339-152896361 CAGTAGATAAAGAAAGCAGGAGG + Intergenic
965337125 3:167440065-167440087 TACTTGGTAGAGAGAGGAGGAGG - Intergenic
967001935 3:185344159-185344181 TAGCAGGTATAGACAGTAGATGG - Intronic
971196512 4:24475482-24475504 TACTAGCTGTAGGAAGGAGGGGG - Intergenic
971835486 4:31757831-31757853 TAGTAGTGGTAGAGAGGAGGAGG + Intergenic
973877579 4:55235400-55235422 AAGTAGGTAAAGAAAGAAGCTGG + Intergenic
974545032 4:63292309-63292331 TACCAGTTATAGAGAGGAGGAGG - Intergenic
974820080 4:67055727-67055749 TAGTAGATTTAGAAGTGAGGAGG - Intergenic
974831482 4:67194758-67194780 AAGGAGGTAGAGAAAGAAGGTGG + Intergenic
975693934 4:76993111-76993133 TAGTAGGAATAGAAATGTGGAGG + Intronic
976366474 4:84238583-84238605 CAATAGGAATAGAAAGGACGGGG + Intergenic
977858135 4:101920907-101920929 TGTTAGGTATATGAAGGAGGAGG + Intronic
978190060 4:105900331-105900353 TTGTAGGTAGGGAAAGGTGGTGG + Intronic
978380027 4:108117404-108117426 TGGTGGGAATAGAAAGGTGGAGG - Intronic
979616853 4:122752686-122752708 TAGGAAGTGTAGTAAGGAGGTGG - Intergenic
979675758 4:123408883-123408905 TAGTAGGAAGGGAAAGGGGGCGG + Intergenic
980859048 4:138477496-138477518 TAGTGGCTATAGAAAGAAGGTGG + Intergenic
982812293 4:159841056-159841078 TTGGAGGTTCAGAAAGGAGGAGG - Intergenic
986825171 5:11512560-11512582 TGTCAGATATAGAAAGGAGGTGG - Intronic
986899697 5:12416293-12416315 TTTTAGGAATAGGAAGGAGGAGG + Intergenic
988464983 5:31481461-31481483 AAGTAGATATAGAAAGGAAAAGG + Intronic
989626460 5:43434085-43434107 AAGTAAGTATACAAAGGAGAGGG - Intergenic
990494931 5:56337993-56338015 GAGGAGGAACAGAAAGGAGGAGG - Intergenic
991543681 5:67758017-67758039 GAGTAGGTAAACAAAGCAGGTGG + Intergenic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
993667734 5:90721921-90721943 TAGTAGGTACAGAAATAAGGAGG + Intronic
993761111 5:91798647-91798669 TAGAAGGTAGAGAAAGGTGGAGG + Intergenic
995489821 5:112679184-112679206 TAGTAGGTAAACAAAGCAGCTGG - Intergenic
996009110 5:118461139-118461161 TAGTGGGAATATAAAGGAGTTGG - Intergenic
996347391 5:122501768-122501790 TGGTGGGGACAGAAAGGAGGGGG + Intergenic
996457908 5:123706194-123706216 AAGTAGGAATAAAAAGGAAGAGG + Intergenic
997045705 5:130314138-130314160 GAGTAGAAATAGAAAGGAAGTGG - Intergenic
997777254 5:136621754-136621776 GAGTAAATTTAGAAAGGAGGTGG + Intergenic
999660741 5:153860361-153860383 TAGAAGGTAAAGAAAAGAGAAGG + Intergenic
1005283891 6:24303459-24303481 CAGTAGGTGGAGAAATGAGGAGG - Intronic
1006402043 6:33823326-33823348 TAGCATTAATAGAAAGGAGGAGG - Intergenic
1006433375 6:34012243-34012265 TATTGGGTATACAAACGAGGAGG + Intergenic
1007181544 6:39932570-39932592 TTGTGGGGATAGAAAGGCGGAGG + Intronic
1007554344 6:42753561-42753583 GAGTAGTTATAGATAGGAGGAGG + Intronic
1010042356 6:71400338-71400360 TAGGAGGTGTAAAAATGAGGAGG + Intergenic
1010149986 6:72719955-72719977 TATCAGGCATAGAAAGGATGAGG - Intronic
1010890715 6:81307025-81307047 TAGTAGCTATGGGAAGGGGGTGG + Intergenic
1012809540 6:103939802-103939824 TAGTAGTAATAGAAAGCTGGTGG + Intergenic
1014362099 6:120491471-120491493 TAGAAGATATAAAATGGAGGTGG + Intergenic
1014494366 6:122102247-122102269 GAGGAGGAAGAGAAAGGAGGAGG + Intergenic
1014873242 6:126622941-126622963 TATTAGGTAGAGAAATGATGAGG + Intergenic
1014923936 6:127248108-127248130 TAGTAGATTAAGAAATGAGGTGG + Intergenic
1015932601 6:138376315-138376337 CAGTAAGCATAGAAGGGAGGAGG - Intergenic
1016830944 6:148432576-148432598 CACTAGGTACAGGAAGGAGGAGG - Intronic
1016984804 6:149887176-149887198 CAGTAGGGATTTAAAGGAGGTGG - Intronic
1017652741 6:156598199-156598221 GAGTAGGCTTTGAAAGGAGGCGG + Intergenic
1017940146 6:159045584-159045606 CAGGAGTTACAGAAAGGAGGAGG - Intergenic
1019818631 7:3221241-3221263 TACTAGGGATAGACAGGAAGAGG - Intergenic
1019892056 7:3954660-3954682 TAGAGGGTGTAGAAGGGAGGTGG - Intronic
1020502089 7:8936167-8936189 TAGAAGGTAGCAAAAGGAGGTGG + Intergenic
1021336366 7:19407647-19407669 GTGTAGATAGAGAAAGGAGGAGG - Intergenic
1022052105 7:26686346-26686368 AAGGAGGAAGAGAAAGGAGGAGG + Intronic
1022972792 7:35532566-35532588 AAGGAGGAATGGAAAGGAGGTGG + Intergenic
1023114774 7:36851868-36851890 TAGTAGTAATAGAAATGGGGAGG - Intergenic
1023396479 7:39756536-39756558 TAATAGATATAGAAAGTAGGAGG + Intergenic
1024115759 7:46191534-46191556 CAGTAGGTATAGGATGGGGGTGG - Intergenic
1024293078 7:47820361-47820383 TACTACTTATAGAAAGAAGGAGG + Intronic
1032523588 7:132563286-132563308 GAGGAGGAAGAGAAAGGAGGAGG - Intronic
1033187253 7:139239166-139239188 TAATATGTATAAAAAGGGGGTGG - Intronic
1034459494 7:151190734-151190756 TAGGAGGCAGAGCAAGGAGGTGG + Intergenic
1035326530 7:158069613-158069635 TTGTGGGTAAAGAATGGAGGAGG - Intronic
1035882236 8:3255530-3255552 GAGTAGGTAAACAAAGCAGGTGG - Intronic
1037409594 8:18582444-18582466 TAGGAGGAAGAGAAAGGAGGAGG - Intronic
1037951022 8:23018896-23018918 GAGTTGGTCTAGAGAGGAGGAGG + Intronic
1038809299 8:30823536-30823558 CACTAGGTAAAGAAAGGATGAGG + Intergenic
1040628496 8:49179992-49180014 GAGGAGGTAGAGAAGGGAGGTGG + Intergenic
1040975855 8:53194162-53194184 TGGTAGATAGAAAAAGGAGGCGG + Intergenic
1041527262 8:58821296-58821318 TAGTAGGTATAGAAAGGAGGGGG - Intronic
1042132615 8:65602710-65602732 TAATGGCTATAGAAAGAAGGTGG + Exonic
1042308699 8:67358614-67358636 GAGTAGGTAAAGAAAGCAGCCGG - Intergenic
1043974515 8:86569857-86569879 TAGTAGGGAAAGAAAGAAGTAGG + Intronic
1044906920 8:97014195-97014217 CAGTAGGAATGTAAAGGAGGGGG + Intronic
1045085678 8:98681302-98681324 TAGAGAGTATAGAAAGGTGGAGG - Intronic
1045897137 8:107233191-107233213 CAGGAGGTAGAGAAAGGAGAAGG + Intergenic
1045957031 8:107920115-107920137 TAGGAGGAAGAGAAAGAAGGAGG + Intronic
1048143147 8:131814916-131814938 TAGAAGGTAAACAAAGGAGAAGG - Intergenic
1048447151 8:134499914-134499936 TAGGAGGAGTAGGAAGGAGGGGG + Intronic
1049431766 8:142568642-142568664 TTGTGGGTGTGGAAAGGAGGCGG - Intergenic
1049469258 8:142768199-142768221 GAGGAGGAATAGAGAGGAGGAGG + Intronic
1049840341 8:144767001-144767023 TTCTAGGTCTAGAAAGGATGTGG - Intergenic
1049894070 9:97604-97626 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1050459737 9:5867393-5867415 TAGTAGGTCTAGGAGGCAGGGGG + Intergenic
1050992494 9:12171471-12171493 TAGTAGGGATAGAAATTAGTAGG + Intergenic
1051129269 9:13841341-13841363 AAGGAGGGAGAGAAAGGAGGAGG + Intergenic
1051164257 9:14245297-14245319 TGGTAGGAATAGAAAGAAGGAGG - Intronic
1051487577 9:17625389-17625411 TAGGAGGCAATGAAAGGAGGTGG - Intronic
1051560776 9:18438195-18438217 TCATAGGAAGAGAAAGGAGGGGG + Intergenic
1051982821 9:23045417-23045439 GACTAGGTAAAGAAAGGGGGAGG + Intergenic
1052493859 9:29201094-29201116 CAGTATGCATAGAAAGGAGGAGG - Intergenic
1052549716 9:29932285-29932307 TAGAAGCTATAGACTGGAGGAGG - Intergenic
1053735296 9:41097688-41097710 TAGTGGGCATGGAAGGGAGGGGG - Intergenic
1054693083 9:68333709-68333731 TAGTGGGCATGGAAGGGAGGGGG + Intronic
1054871840 9:70054316-70054338 GATTAGGTATAGGAAGGAGATGG + Intronic
1057181575 9:93033470-93033492 GAGGAGGGAGAGAAAGGAGGAGG - Intronic
1057983713 9:99688078-99688100 TAGCTGGAATAGAAAGGAAGAGG - Intergenic
1058150599 9:101459606-101459628 TTCAAGGTATTGAAAGGAGGTGG + Intergenic
1058473013 9:105300385-105300407 TAAAAGGTATAGTAAGAAGGGGG - Intronic
1058568204 9:106309907-106309929 TACTCTGTAAAGAAAGGAGGAGG + Intergenic
1058639014 9:107064996-107065018 TGGTAGGAACAGAAAGGAGAGGG - Intergenic
1059072434 9:111152866-111152888 AAGTAGGAAGAGAAAGAAGGAGG + Intergenic
1061108413 9:128550333-128550355 TAGTAGGTGTGGAAAGCTGGGGG - Intergenic
1061306445 9:129735792-129735814 TGGTGGGTATGGAAGGGAGGTGG - Intergenic
1187283644 X:17882371-17882393 TAGATGGTATTGAAAGGAAGAGG + Intergenic
1187542963 X:20216569-20216591 TAGCAGATATGGAAAGGGGGGGG + Intronic
1188030190 X:25255185-25255207 TTGTATGGGTAGAAAGGAGGAGG + Intergenic
1188047360 X:25441721-25441743 AAGTAGGAATAGAGGGGAGGAGG + Intergenic
1188944225 X:36278260-36278282 GAGTAGGTAAAGAAAGAAGCTGG - Intronic
1189407951 X:40742816-40742838 TACTAGAAATAGAAACGAGGAGG + Intergenic
1191775524 X:64808845-64808867 TAGTAGGTAAACAAAGCAGCTGG + Intergenic
1192571461 X:72209604-72209626 TAGTAGAGATGGAAAGAAGGTGG - Intronic
1192857268 X:75025478-75025500 GAGTAGGTAAACAAAGCAGGTGG - Intergenic
1195370822 X:104170515-104170537 TAGCAGGGAAAGAAAGGAGAAGG + Intronic
1197607755 X:128605383-128605405 TAGTGGGAATTGAAAGGAGAAGG - Intergenic
1198995373 X:142567806-142567828 TAGTAGGTAGAGCAAGATGGTGG - Intergenic
1199470596 X:148191464-148191486 TAGGAGGTAGATAAAGAAGGAGG - Intergenic
1199480758 X:148296420-148296442 TAATGGGAATAGAAAGGAGTTGG - Intergenic
1200395568 X:155984907-155984929 TAAAAGGAATAGAGAGGAGGAGG - Intergenic