ID: 1041527313

View in Genome Browser
Species Human (GRCh38)
Location 8:58821921-58821943
Sequence GAGTCTGTAGTCTCTGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041527313_1041527320 10 Left 1041527313 8:58821921-58821943 CCCGCCCCAGAGACTACAGACTC 0: 1
1: 0
2: 1
3: 17
4: 223
Right 1041527320 8:58821954-58821976 GGACTCTCCCAGTATGATAGAGG No data
1041527313_1041527321 13 Left 1041527313 8:58821921-58821943 CCCGCCCCAGAGACTACAGACTC 0: 1
1: 0
2: 1
3: 17
4: 223
Right 1041527321 8:58821957-58821979 CTCTCCCAGTATGATAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041527313 Original CRISPR GAGTCTGTAGTCTCTGGGGC GGG (reversed) Intronic
900487218 1:2928815-2928837 CAGCCTGCAGTCTCTGCGGCTGG - Intergenic
900657983 1:3769544-3769566 GAGTCTTTGGGCTTTGGGGCTGG + Intronic
900796831 1:4713044-4713066 GAGAATTTTGTCTCTGGGGCCGG + Intronic
900916597 1:5643973-5643995 GAGTCTGGGATCTCTGTGGCAGG - Intergenic
901526379 1:9825377-9825399 GAATCTGTAGGCTTTGGTGCAGG - Intergenic
901777921 1:11573351-11573373 GAGTTTGAAATCTGTGGGGCAGG + Intergenic
903686929 1:25138765-25138787 GCCTCTGTTGTCTCTGGGGCTGG - Intergenic
905245475 1:36610264-36610286 GAGTCTGTAGACTCAGATGCTGG + Intergenic
905390259 1:37631509-37631531 AAGTCTGTAGTCTCAGAGGCTGG + Intronic
905671570 1:39794032-39794054 GAGTCTTTAGTCAATGGGTCAGG + Intergenic
907163432 1:52388569-52388591 GAGTCTGAAATCTCTGCTGCTGG + Exonic
908351032 1:63286472-63286494 GAACCTGTATCCTCTGGGGCAGG - Intergenic
908606036 1:65797817-65797839 GAGTCGGGAGACTCTGGGCCTGG + Intronic
908784076 1:67717801-67717823 GAGTAGGTATTCTCAGGGGCTGG + Intronic
909468276 1:75999182-75999204 AAGTCTGTAGTCTCGGAGGGAGG - Intergenic
909524761 1:76610496-76610518 GAGTATGTTGTCCCTGAGGCTGG + Intronic
913479755 1:119276689-119276711 AAGTCTGAAGTCTGTAGGGCAGG + Intergenic
913572381 1:120133645-120133667 GAGTCAAAAGTCACTGGGGCAGG + Intergenic
914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG + Intergenic
914928653 1:151909897-151909919 AAGACTGAAGTCCCTGGGGCGGG + Intergenic
916489508 1:165289055-165289077 GAGGCTGGAGTCTCTGGTGTGGG - Intronic
918405635 1:184209088-184209110 GAGTCTGGGGGCTCTGGGCCAGG + Intergenic
919754152 1:201056308-201056330 AAGTCTGGAGTCTCTGAGGAAGG - Intronic
922556325 1:226535223-226535245 AAGTCTGAAGTCTGTAGGGCAGG + Intergenic
1062983630 10:1746132-1746154 GTCTGTGTAGCCTCTGGGGCAGG + Intergenic
1064793342 10:18984383-18984405 GAATCTGAAATCTATGGGGCAGG - Intergenic
1065312289 10:24428059-24428081 GAATTTGTAGTCTCTGGAGCAGG - Intronic
1066374229 10:34842983-34843005 ATGCCTGTAGTCTCTGAGGCAGG + Intergenic
1066535388 10:36385385-36385407 GAGTCTGGAGTCTGTAGGCCTGG + Intergenic
1067234848 10:44438957-44438979 GAGACTGTAGGCTCTGGGGGAGG + Intergenic
1068613412 10:59085827-59085849 GAGTCTGTGGTCTGTGGGAATGG + Intergenic
1069087708 10:64160599-64160621 AAGTCTGAAGTCTGTAGGGCAGG + Intergenic
1069743372 10:70699693-70699715 GAGTCACTAGGCTGTGGGGCAGG + Intronic
1070672032 10:78384645-78384667 TAGGCTGTAGTTTCTGAGGCTGG + Intergenic
1076750156 10:132538270-132538292 GAGTCTGGGGCCTCTGGGTCTGG - Intronic
1079031929 11:16992370-16992392 CTGTCTGTGGTCTCTGGGTCTGG + Intronic
1079069379 11:17329607-17329629 GAGTCTGTGCCCTCTGGGGAGGG - Intronic
1079882517 11:25944667-25944689 CAGTCTGGAAGCTCTGGGGCGGG - Intergenic
1080249194 11:30213974-30213996 GAGTCTGTGGTCACCTGGGCTGG - Intergenic
1081663703 11:44904112-44904134 GAGCCTGGAGTCCCTGGGTCAGG + Intronic
1082962838 11:58935101-58935123 GAGCCTGGAGTCACTGGGGCTGG + Intronic
1082976467 11:59077178-59077200 GAGCCTGGAGTCACTGGGGCTGG + Intergenic
1087771971 11:102220653-102220675 GGGTCTGGAGTCTCTGAGGTTGG + Intronic
1092612775 12:10189253-10189275 GAGTCTATAGTATCGGGGGCTGG + Intronic
1098411434 12:70188512-70188534 GACTCTGTGCTCTCTGGGACTGG + Intergenic
1100594659 12:96061470-96061492 CTGTCTGTAGGCTCTTGGGCAGG + Intergenic
1101272947 12:103167196-103167218 AGGTCTGTAGTACCTGGGGCTGG - Intronic
1103222911 12:119260844-119260866 GAGTATATAATCTCTGGGTCTGG - Intergenic
1103341860 12:120225054-120225076 GGGCCTGGAGCCTCTGGGGCCGG - Intronic
1103571261 12:121846671-121846693 GAGACTGAACTCTCTGGGGGTGG + Intronic
1104678791 12:130734325-130734347 GAGTCTGCACTCACTCGGGCTGG - Intergenic
1107744265 13:43488380-43488402 GATTCTGTTGTCTGTGGTGCTGG - Intronic
1108997557 13:56753363-56753385 GAGACTGTAGTCTCAGGTACTGG + Intergenic
1113191472 13:107752691-107752713 GAGTCTGTAGTCTCTTTGGAAGG - Intronic
1116731571 14:48629233-48629255 AAGTCTGAAGTCCATGGGGCAGG - Intergenic
1117005656 14:51418778-51418800 GCCTCTGTAGTCTCTGCCGCTGG - Intergenic
1121450045 14:94001281-94001303 GAGCCTGGAGTCTCTGGAGGAGG + Intergenic
1127588999 15:60404436-60404458 GCGGCTGTAGCGTCTGGGGCCGG - Intergenic
1127788258 15:62375570-62375592 GAGGCTGCTGTCTTTGGGGCGGG - Intergenic
1129999021 15:80031425-80031447 GAGTGTGAAGACTCTGAGGCAGG + Intergenic
1130997860 15:88913599-88913621 GAGTCTTGAGTCTGTTGGGCGGG + Intergenic
1132557598 16:579439-579461 GCATCTCTAGTCTCTGGGCCCGG - Intronic
1134165777 16:11928145-11928167 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1134494945 16:14725595-14725617 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1134500328 16:14764715-14764737 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1134526870 16:14951327-14951349 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1134545535 16:15105021-15105043 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1134580251 16:15364335-15364357 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1134714447 16:16349804-16349826 GACTCTGTCTTCCCTGGGGCAGG + Intergenic
1134722322 16:16393168-16393190 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1134805384 16:17119792-17119814 GAGAATGCAGCCTCTGGGGCTGG - Intronic
1134945105 16:18318701-18318723 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1134952369 16:18358854-18358876 GACTCTGTCTTCCCTGGGGCAGG - Intergenic
1135311170 16:21405559-21405581 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1135364122 16:21838010-21838032 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1135447720 16:22533338-22533360 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1135961323 16:26996754-26996776 GAGTCTGAGGTCCCTGGGGATGG - Intergenic
1136150324 16:28343454-28343476 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1136166561 16:28457292-28457314 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1136196414 16:28657740-28657762 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1136212754 16:28771865-28771887 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1136257476 16:29051784-29051806 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1136307874 16:29384555-29384577 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1136321290 16:29486099-29486121 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1136435970 16:30226069-30226091 GACTCTGTCTTCCCTGGGGCAGG - Intronic
1137519222 16:49177944-49177966 CATTCTGGAGACTCTGGGGCTGG + Intergenic
1139855563 16:69976998-69977020 GACTCTGTCTTCCCTGGGGCAGG - Intergenic
1140367170 16:74391103-74391125 GACTCTGTCTTCCCTGGGGCAGG + Intronic
1141115071 16:81301446-81301468 GAGTTTGTGGTTTCTGGGGTTGG + Intergenic
1141220375 16:82063922-82063944 GAGTTTGGAGGCTCTGGGTCTGG + Intronic
1142527442 17:554087-554109 AAGTCTGTAGTTCATGGGGCAGG - Intronic
1142673904 17:1501654-1501676 GTGTCTGTGGTCTCTGGGATGGG - Intronic
1143770191 17:9163536-9163558 GAGTCGGCAGTTTCAGGGGCAGG + Intronic
1143774404 17:9188532-9188554 GAGTCTGATTTGTCTGGGGCTGG + Intronic
1147841854 17:43377478-43377500 GAGCCTGCATTCTCTGGGACAGG - Intergenic
1148601015 17:48894202-48894224 GAGACAGCTGTCTCTGGGGCAGG + Intronic
1148714454 17:49705990-49706012 GAGGCTGAGGTCTCTGGTGCAGG - Intronic
1150291448 17:63984825-63984847 GAGTCTGTAGTAGCAGGCGCAGG - Intergenic
1150859528 17:68786972-68786994 GAATCTGTAATCTCTCTGGCAGG - Intergenic
1151097456 17:71514879-71514901 GTGACTGGAGTCTCTGGTGCAGG + Intergenic
1151649411 17:75456939-75456961 GAGTCTGAAGACTCGGGGGAAGG - Intronic
1153107397 18:1543088-1543110 GTGTCTGTAGTCCCAGGGACTGG - Intergenic
1154117036 18:11620186-11620208 GACTCTGTCTTCCCTGGGGCAGG - Intergenic
1154497989 18:14976408-14976430 GAGTCTGTACTCTCTGACCCTGG + Intergenic
1155990530 18:32274757-32274779 GAGTGTGTAATGTGTGGGGCTGG - Intronic
1156039934 18:32809340-32809362 GACTCTATATTATCTGGGGCTGG - Intergenic
1156318362 18:35993676-35993698 GAGTCTGTGGTGTCTGAAGCAGG + Intronic
1156800008 18:41099218-41099240 GAGTCTGTATTCCAGGGGGCTGG - Intergenic
1158646704 18:59254882-59254904 CAGTCTGTTGGCTCTGAGGCAGG - Intergenic
1162028252 19:7906121-7906143 GAGTCTGTGGCCTCCGGGGGTGG + Intronic
1162631198 19:11928435-11928457 GAGAAAGTAGTCTCTGGGCCGGG + Intronic
1163250890 19:16125709-16125731 CAGTGTGTGGTCCCTGGGGCCGG - Intronic
1164386944 19:27779830-27779852 GTGTCTGTAGTCTCAGGTACTGG - Intergenic
1167149398 19:47700061-47700083 GAGTCTGAAGTCTCTAGGGTAGG + Intronic
1167602599 19:50463238-50463260 GGCCCTGTAGTCTCTGGGCCTGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925731374 2:6921629-6921651 GAGGCTGTAGTCTAGGGAGCGGG + Intronic
927362071 2:22247725-22247747 GATTCTGTTTTCTCTGAGGCAGG + Intergenic
927511729 2:23648194-23648216 GAGCCTGTATGGTCTGGGGCAGG - Intronic
927599223 2:24425703-24425725 GAGTTTGTAGTCTCTGGAAATGG + Intergenic
930693399 2:54387193-54387215 GAGTGTGTGGTCCCAGGGGCTGG + Intergenic
932700501 2:73988027-73988049 GAGTCTGCAGTCCCTGGGTCAGG - Intronic
933850966 2:86366430-86366452 TACTCTGTGGTCTCTGGAGCTGG + Intergenic
937137731 2:119569243-119569265 GTGCCTGTAGTCCCTGAGGCAGG - Intronic
937921017 2:127130822-127130844 GAGTCTGAAATCTGTAGGGCAGG + Intergenic
940871231 2:158862113-158862135 GAATCTGGTGTCTCTGAGGCAGG + Intronic
942059528 2:172215436-172215458 GAGTCTGTAGTCTCATCGGGAGG + Intergenic
942418143 2:175780389-175780411 GACTCTGTTTGCTCTGGGGCAGG + Intergenic
943203566 2:184860880-184860902 GAGTCTTGGGTCTCTGGGGTTGG + Intronic
944010465 2:194968222-194968244 GAGTATGTAGTCTCTGGCATTGG + Intergenic
945638046 2:212384101-212384123 GAGTTTGTAGCCACTGGGTCTGG - Intronic
946143162 2:217709002-217709024 AAGTCTCTAGTATTTGGGGCTGG - Intronic
947736806 2:232459407-232459429 AAATCTGCAGTCTCTGGGGTTGG - Exonic
947816792 2:233042756-233042778 GAGGCTGAAGTCCCTGGGTCGGG - Intergenic
948822498 2:240557283-240557305 GAGGACGAAGTCTCTGGGGCTGG - Exonic
1170524704 20:17226648-17226670 GAATCTGTAGGCTCTGGGAAGGG - Intronic
1170777680 20:19391713-19391735 GAGTCTTCAGTCTTTGGGACGGG + Intronic
1171284885 20:23928889-23928911 GAGTCTGCAATGGCTGGGGCCGG - Intergenic
1171353907 20:24528898-24528920 TAGTTTGTAGTGTTTGGGGCTGG - Intronic
1172101044 20:32484014-32484036 GAGGCTGCGGTCTCTGGGTCCGG + Intronic
1172350266 20:34233489-34233511 CAGTATGTAGTCTTTGTGGCTGG - Intronic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1173059880 20:39650988-39651010 GTGTCTGGAGTCTCTGTGTCTGG + Intergenic
1175951841 20:62587811-62587833 GAGTGTGTGGTGTGTGGGGCTGG - Intergenic
1175978161 20:62723935-62723957 GAGGCAGCAGCCTCTGGGGCAGG + Intronic
1177232502 21:18340758-18340780 TGGTCTGTAGTCTTTGGGGAGGG - Intronic
1178381766 21:32115721-32115743 AAGTCTGAAGTCTCTAGGGCAGG - Intergenic
1180959207 22:19755104-19755126 GGGTTTGCAGCCTCTGGGGCGGG - Intergenic
1181024958 22:20122873-20122895 GTGTGTGTGGTGTCTGGGGCAGG + Intronic
1182316989 22:29454305-29454327 GAGAGTGTACTCTCTGGGCCAGG - Intergenic
1182555125 22:31125109-31125131 GAGCCTGTGGTCGCTGGGGGAGG - Exonic
1182919211 22:34064167-34064189 GAGTCTTTAGGATCTGGGTCTGG - Intergenic
1183012681 22:34959909-34959931 GAGGATGCAGTTTCTGGGGCTGG - Intergenic
1183549056 22:38470594-38470616 AAGTCTCTGGTCTTTGGGGCTGG - Intronic
1183950540 22:41350176-41350198 CAGACTGAAGTCTCTGAGGCAGG + Intronic
1183971953 22:41484061-41484083 AAGTTTGTTGTCTTTGGGGCAGG + Intronic
959068140 3:101678057-101678079 GGGTCTGTAGTCTCTGGGTGAGG + Intergenic
963776826 3:149448373-149448395 GAGGCTTTAGTCTCTTCGGCAGG - Intergenic
965322380 3:167265912-167265934 GAATCTGTGCTCTCTGGGGAGGG - Intronic
968429281 4:545841-545863 GAGTCTGTGGGCACTGGGGGAGG - Intergenic
969210099 4:5680892-5680914 AAGCCTGCAGTCTGTGGGGCGGG - Intronic
969537202 4:7763725-7763747 GGGTGTGCAGTCTCTGAGGCTGG + Exonic
969666367 4:8559653-8559675 GAGTCTGAGGTCTATAGGGCAGG - Intronic
972701547 4:41498834-41498856 GAGTCTATAGGATCAGGGGCTGG + Intronic
975641572 4:76505780-76505802 GAGCCTGTAGTCTCTTTGGAAGG - Intronic
979670034 4:123352072-123352094 GAGGCTGTTGTCTATGGGGACGG - Intergenic
980660479 4:135851649-135851671 GTGTATGTGGTCTCTGTGGCAGG - Intergenic
982112230 4:152067245-152067267 GAGTCTGTTGTTTCTGTGTCTGG + Intergenic
984096226 4:175438098-175438120 GAGGCTGGAGTCTCAGGTGCTGG + Intergenic
984303053 4:177948897-177948919 GACTCTGCAGTCTCGGGGGATGG - Intronic
984405452 4:179324132-179324154 AAGTCTGAAGTCTCTGGGGCGGG - Intergenic
984767852 4:183413313-183413335 GAGCCTGGAGGGTCTGGGGCTGG + Intergenic
986403908 5:7406508-7406530 CAATCTCTAGTCTCTGGGCCAGG - Intronic
988470340 5:31531910-31531932 GGGGCTGGAGTCTCCGGGGCTGG - Intronic
989773381 5:45171873-45171895 GAGTCTGAAGCCTGTGGGGAGGG - Intergenic
990598676 5:57335846-57335868 GAGTATGTGGGATCTGGGGCTGG - Intergenic
992133250 5:73716641-73716663 GAGTCTGCGGTAGCTGGGGCTGG - Intronic
995037492 5:107551550-107551572 GGGTCTCTAGTCTCTGCTGCTGG - Intronic
995845764 5:116492142-116492164 GACTCTGTGGTCTGTGGGTCTGG + Intronic
999136166 5:149320794-149320816 GATTCCGTGGTGTCTGGGGCAGG + Intronic
999725612 5:154434927-154434949 GAGTCTCTTGTCACTGAGGCTGG - Intergenic
1000669819 5:164047157-164047179 GAATCTGTTGTATTTGGGGCAGG - Intergenic
1000758598 5:165192343-165192365 GAGTCTGAAATCTGTAGGGCAGG + Intergenic
1002440458 5:179261914-179261936 GAGGCTGTGCTCTGTGGGGCGGG - Intronic
1005704115 6:28434734-28434756 CAGTGTGGAGTCTCTGGTGCTGG + Exonic
1006389619 6:33750876-33750898 GAGGTTGTTGTCTCTAGGGCAGG - Intergenic
1006653703 6:35572093-35572115 AAGCCTGTATTCTCTGGGGCTGG - Intergenic
1007596432 6:43053785-43053807 GAGTCGGCAGCCACTGGGGCAGG + Exonic
1008495587 6:52130304-52130326 GAGGTTGTAGTCTCTGAGCCAGG - Intergenic
1014018692 6:116564211-116564233 GAATCTGTGCTCTCTTGGGCTGG + Intergenic
1015537648 6:134282796-134282818 AAGTCTGAAATCTGTGGGGCAGG - Intronic
1017242423 6:152185298-152185320 GAGTCTGGAGTACCTGGGACTGG - Intronic
1019088536 6:169503530-169503552 CAGGCTGTAGTGTCTGGGGACGG - Intronic
1019767291 7:2861055-2861077 CAGTCTGTAGTCTGCAGGGCAGG - Intergenic
1019989439 7:4681881-4681903 GGGCCTGGAGTGTCTGGGGCGGG + Intergenic
1022474346 7:30700194-30700216 GAGGCTGTGGGCTGTGGGGCGGG - Intronic
1022505077 7:30904731-30904753 GAGTCTGCAGTCCCTGCCGCAGG - Intergenic
1022789676 7:33674231-33674253 CTGTCTTTGGTCTCTGGGGCTGG + Intergenic
1023103022 7:36737998-36738020 TTGTCTGTAGTCTCTGGGAAAGG + Intergenic
1023816120 7:43951287-43951309 GTGTCTGTAGTTGGTGGGGCAGG + Intronic
1023863506 7:44228424-44228446 GGGTGTGAAGTCTGTGGGGCTGG + Intronic
1026730841 7:72910650-72910672 GTGTCTACAGTATCTGGGGCAGG + Intronic
1027113248 7:75457519-75457541 GTGTCTACAGTATCTGGGGCAGG - Intronic
1027285498 7:76642114-76642136 GTGTCTACAGTATCTGGGGCAGG - Intergenic
1034629782 7:152522046-152522068 GAGATTCTAGTCTCTGTGGCAGG + Intergenic
1036175656 8:6535928-6535950 GAGCCTGTAGTCTCAGGTACTGG + Intronic
1037794771 8:21983662-21983684 ATGTTTGTAGGCTCTGGGGCCGG + Intronic
1038494092 8:27989709-27989731 GAGTGGGTGGTGTCTGGGGCAGG - Intronic
1040533791 8:48288268-48288290 GCCTCTGCAGGCTCTGGGGCAGG + Intergenic
1041527313 8:58821921-58821943 GAGTCTGTAGTCTCTGGGGCGGG - Intronic
1041808974 8:61886912-61886934 GTGTCTGGAGTCACTGGGGTTGG + Intergenic
1045906097 8:107346912-107346934 GAGTCTGTGGACTCTGGCCCTGG + Intronic
1046135404 8:110019526-110019548 GAGTTTCTAGGCTGTGGGGCAGG - Intergenic
1046627083 8:116586459-116586481 AAGTCTGAAGTCTATAGGGCAGG + Intergenic
1048072642 8:131039055-131039077 GGGTCTGCAGTCTCCGGAGCAGG - Intronic
1049022983 8:139970541-139970563 GTGTCTGAGGTCTCTGGGACAGG - Intronic
1049642026 8:143720126-143720148 GAGGCTGTGCTCCCTGGGGCTGG + Intronic
1049769692 8:144374149-144374171 GGGTCTCGGGTCTCTGGGGCTGG - Intronic
1053070694 9:35100117-35100139 GAGTCTGGAGTCCCTGGCACTGG + Exonic
1053272362 9:36759180-36759202 GTGTCTGGAGCCTCTGGGGAGGG + Intergenic
1054768921 9:69066944-69066966 GAGCCTGTGGTCTCTGGGTGTGG - Intronic
1055077043 9:72226820-72226842 AATTCTGTAGTCACTGGGCCGGG + Intronic
1056753005 9:89365174-89365196 GGGTCTGTACGCTCTGGGGCTGG - Intronic
1056915620 9:90743661-90743683 GAATCTAGTGTCTCTGGGGCAGG - Intergenic
1057701650 9:97367181-97367203 TAGTATGTAGTCTTTGGGACTGG + Intronic
1057972657 9:99572451-99572473 GAGCCTCTATTCTCTGGGACTGG + Intergenic
1058342605 9:103917548-103917570 GAGCCTGGGGTCACTGGGGCTGG + Intergenic
1059800166 9:117742102-117742124 TAGTCGGCAGTCTCTGGAGCTGG - Intergenic
1060045539 9:120337312-120337334 GAGTGTGTGGTCACTGGGGTGGG - Intergenic
1060331612 9:122676541-122676563 TAGCCTGTAGTCTCATGGGCAGG - Intergenic
1060822522 9:126669766-126669788 GGGTCAGTTGTCTCTAGGGCAGG + Intronic
1061207942 9:129175200-129175222 GAGTCTGAGCTCTCTGTGGCCGG - Intergenic
1062272007 9:135714088-135714110 GAGACGGGGGTCTCTGGGGCTGG + Intronic
1062491976 9:136809299-136809321 GAGGCCGTAGTTCCTGGGGCTGG + Intronic
1062526850 9:136981361-136981383 GAGTCTGTGGACCCTGGGGCTGG + Intronic
1062566997 9:137167929-137167951 GGGTGGGCAGTCTCTGGGGCGGG - Exonic
1186556975 X:10570107-10570129 GAGTCTGTGTTTTCTGGGGCTGG - Intronic
1186661871 X:11676571-11676593 AAGTCTGTAGCCTCTGGATCTGG - Intergenic
1194264062 X:91733929-91733951 GACTCTGTAGCCGCTTGGGCAGG - Intergenic
1198963547 X:142205641-142205663 GAGGCTGTTGTCTCTGAGGAGGG - Intergenic
1199760157 X:150898809-150898831 GAGGCTGCAGTATCGGGGGCGGG + Intronic
1201897386 Y:19006395-19006417 AACTCTGTAGTCTCTGCGGGTGG - Intergenic