ID: 1041531857

View in Genome Browser
Species Human (GRCh38)
Location 8:58877912-58877934
Sequence TCATTTGTTCTGATTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041531854_1041531857 16 Left 1041531854 8:58877873-58877895 CCTCAGGAAAACTTTCCAATTGA 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1041531857 8:58877912-58877934 TCATTTGTTCTGATTGCTCAGGG No data
1041531855_1041531857 1 Left 1041531855 8:58877888-58877910 CCAATTGATTTTGCTTACTCTTA 0: 1
1: 0
2: 0
3: 22
4: 273
Right 1041531857 8:58877912-58877934 TCATTTGTTCTGATTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041531857 Original CRISPR TCATTTGTTCTGATTGCTCA GGG Intronic
No off target data available for this crispr