ID: 1041533928

View in Genome Browser
Species Human (GRCh38)
Location 8:58904634-58904656
Sequence ACTCTTAAGCAGTAGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041533926_1041533928 8 Left 1041533926 8:58904603-58904625 CCAGTAATCACTTTTATTTAGTT 0: 1
1: 0
2: 0
3: 36
4: 460
Right 1041533928 8:58904634-58904656 ACTCTTAAGCAGTAGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041533928 Original CRISPR ACTCTTAAGCAGTAGCAGCA GGG Intronic
No off target data available for this crispr