ID: 1041539543

View in Genome Browser
Species Human (GRCh38)
Location 8:58967462-58967484
Sequence GGAACAGTGTCAGCTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041539543_1041539544 -6 Left 1041539543 8:58967462-58967484 CCAGGAACAGCTGACACTGTTCC 0: 1
1: 0
2: 1
3: 11
4: 181
Right 1041539544 8:58967479-58967501 TGTTCCCATGTAGCCTCCAGAGG No data
1041539543_1041539551 30 Left 1041539543 8:58967462-58967484 CCAGGAACAGCTGACACTGTTCC 0: 1
1: 0
2: 1
3: 11
4: 181
Right 1041539551 8:58967515-58967537 GCCACCACAGCTACAAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041539543 Original CRISPR GGAACAGTGTCAGCTGTTCC TGG (reversed) Intronic
900355304 1:2258888-2258910 GGAGCAGGGTCAGCAGTGCCTGG + Intronic
900386797 1:2414357-2414379 GTCCCAGTGTCTGCTGTTCCTGG + Intergenic
900555713 1:3279394-3279416 TGAGCAGTGTCAGCCGCTCCGGG + Intronic
901028829 1:6294326-6294348 GAAATGGTGTCAGCTGTCCCTGG - Intronic
905017448 1:34787338-34787360 GGGACAGTGTCAGCCGGCCCTGG - Intronic
908264115 1:62361587-62361609 GTAACAGTGGGAGCTGGTCCAGG + Intergenic
908766346 1:67558272-67558294 GGCACAGTGTCACCTGCTCTGGG - Intergenic
908773344 1:67616032-67616054 GGAAATATGTCAACTGTTCCTGG - Intergenic
909759260 1:79269000-79269022 TGGACACTGTCAGCTGTTGCTGG - Intergenic
911044827 1:93619710-93619732 GGGAGAGAGGCAGCTGTTCCTGG - Intronic
911067088 1:93799813-93799835 GGTATATTGACAGCTGTTCCAGG + Intronic
912488543 1:110048231-110048253 GGCACAGGTTCAGCTGTTGCTGG - Intronic
912754417 1:112312555-112312577 GCCACAGTGGCAGCTGTTGCTGG + Intergenic
915300145 1:154947096-154947118 GGAACAGTGTTAACTGATCATGG + Intronic
915300635 1:154949613-154949635 GGAACAGTGTTAACTGATCATGG + Intronic
915317683 1:155038599-155038621 GGAACAGTATAAGCTGGTCGGGG - Intronic
920323644 1:205144100-205144122 GGCACAGGGTCAGCCATTCCAGG + Exonic
921817192 1:219577240-219577262 GGATTAGTGGCAGCTGCTCCAGG + Intergenic
922870971 1:228901699-228901721 GGAGCAGGGTCAGCTGGTCCTGG + Intergenic
922940162 1:229456500-229456522 TGAACAGTGGGAGCTGTTCAAGG + Intronic
1065307802 10:24384963-24384985 GTAACAGTGTCTGATGCTCCTGG - Intronic
1066460754 10:35610229-35610251 GGAACAGTATCAGATGCCCCTGG - Intergenic
1069799237 10:71072022-71072044 GAAACTGTGTGAGCTGATCCAGG + Intergenic
1075807588 10:125201340-125201362 GGAACCGTGTCAGTGGTTCATGG - Intergenic
1077288731 11:1779126-1779148 GGCACAGTGGCAGGTGTTCCCGG + Intergenic
1078345247 11:10541894-10541916 GCAGCAGTGTCAGCTGTACCTGG - Intergenic
1078444776 11:11395938-11395960 GGCACAAGGACAGCTGTTCCTGG + Intronic
1080103741 11:28489935-28489957 GGAACAGGGTCAGCTGCACAGGG - Intergenic
1081851374 11:46277436-46277458 GGAACACTGTTATCGGTTCCAGG + Intergenic
1083791608 11:64989581-64989603 GGAACAGCTCCAGCTGCTCCCGG + Exonic
1083988337 11:66231513-66231535 GGAACTGTGTAAGGTGTGCCGGG - Intronic
1085534686 11:77211003-77211025 GGAGCAGTGTCAGCTGAGGCTGG + Intronic
1092306926 12:7310834-7310856 GGAACACTGTCAGTTGATCTGGG + Intronic
1092986438 12:13850356-13850378 TGAAGAGTTTCAGCTGATCCAGG + Intronic
1096138222 12:49220555-49220577 GGAAAAATGTCATCTTTTCCAGG - Intronic
1097704856 12:62857602-62857624 GGAACAGATTCAGCTGTTTTGGG + Intronic
1097983728 12:65760709-65760731 GGTTCAGTGTCAGCTGTTCCAGG + Intergenic
1100407657 12:94285293-94285315 GGAACAGTCTCACTTCTTCCTGG - Intronic
1102724831 12:115052433-115052455 AGAAAATTGTCATCTGTTCCTGG + Intergenic
1103201490 12:119091519-119091541 AGACCAGTGTCGTCTGTTCCTGG + Intronic
1104731478 12:131107691-131107713 GGAAAAGGGGCAGCTGGTCCTGG + Intronic
1107113542 13:36723117-36723139 GGGAGAGTTTCAGCTGTTCCAGG + Intergenic
1107542777 13:41408411-41408433 GGTACAGTTTCTGCTTTTCCTGG + Intergenic
1112257517 13:97848742-97848764 GAAACAGTGTCTCCAGTTCCTGG + Intergenic
1113736761 13:112684575-112684597 AGAACATTGTCTCCTGTTCCGGG - Intergenic
1117817421 14:59612076-59612098 GAAAAAGTTTCAGCTTTTCCAGG + Intronic
1118294840 14:64559364-64559386 GTAGCAGTGGCAGCAGTTCCTGG - Intronic
1119219535 14:72894680-72894702 GGAACTGTCGCTGCTGTTCCTGG + Intergenic
1123837294 15:24208975-24208997 GTAAGAGTGTCTGCTTTTCCTGG - Intergenic
1123846502 15:24308741-24308763 GTAAGAGTGTCTGCTTTTCCTGG - Intergenic
1123865508 15:24515793-24515815 GTAAGAGTGTCTGCTTTTCCTGG - Intergenic
1127070473 15:55283510-55283532 GGGACAAGGTCAGCTGTCCCAGG - Intronic
1127529778 15:59832551-59832573 GGAACAGTGTTAGGTGATGCAGG - Intergenic
1129530636 15:76261530-76261552 GGGACACTGTCAGCTTTGCCGGG + Intronic
1130616647 15:85415591-85415613 TGAACAGTGTCACCTGTACTCGG + Intronic
1132286277 15:100665359-100665381 GGACCAGTGTCAGCTGAGACTGG + Intergenic
1135588193 16:23687399-23687421 GGAAGAGTTTCAGCTGTGGCAGG + Intronic
1136067648 16:27769640-27769662 GGACCAGTGTCCGCTGTAGCAGG + Intronic
1138177039 16:54909738-54909760 GGAACAGTGTCACTCGTTCCTGG - Intergenic
1138651971 16:58465787-58465809 GGAAAGGTGGAAGCTGTTCCTGG + Intronic
1139817989 16:69692463-69692485 TGAACACTTTCAGCTCTTCCAGG - Exonic
1140117040 16:72050990-72051012 GGATCAGTTTCAGCTGATCTTGG + Intronic
1141348336 16:83269504-83269526 AGAATAGTGTGAGTTGTTCCTGG + Intronic
1141922256 16:87143957-87143979 GGGTCTGTGCCAGCTGTTCCTGG + Intronic
1142265251 16:89061474-89061496 GGGACAGTGACTGCTGGTCCTGG - Intergenic
1142396885 16:89837179-89837201 GGGTCAGAGTCAGATGTTCCGGG - Intronic
1142399963 16:89853456-89853478 GGAACAGGTACAGGTGTTCCCGG + Intronic
1142425495 16:90000258-90000280 GGCACCGTGTCAGCAGGTCCAGG - Intergenic
1146267161 17:31460281-31460303 GGATCAGTGTCTGCCGTCCCTGG + Intronic
1147911635 17:43859552-43859574 GCAGAAGTGTCACCTGTTCCAGG - Intronic
1148196530 17:45717254-45717276 GTAACTGTGTTACCTGTTCCAGG - Intergenic
1151584725 17:75002136-75002158 GGAGCACTCGCAGCTGTTCCAGG - Exonic
1152260710 17:79265379-79265401 AGGACAGTGTCAGCTGCTGCCGG - Intronic
1152331334 17:79675031-79675053 GGCACAGTGTCTGCTGCTCAGGG - Intergenic
1152799120 17:82322893-82322915 GGAACAGCGGCACCTGTACCAGG + Exonic
1153200518 18:2643057-2643079 GGAATAGTGTTAGCTGTGCAAGG - Intergenic
1153571500 18:6477805-6477827 GAAACTGTGTCTGCTGATCCTGG + Intergenic
1155272428 18:24153568-24153590 AGAACAGTCTCAGCTGTAGCAGG - Intronic
1157282632 18:46356210-46356232 GGAACAGGGTCGGCTGGTCACGG - Intronic
1163129927 19:15265981-15266003 GGAACAAGGGCAGCTGTGCCTGG - Intronic
1165062203 19:33210437-33210459 GGCACAGGGCCAGCTGTCCCAGG + Intronic
1167438481 19:49494249-49494271 GGTGCAGTCTCACCTGTTCCCGG + Intergenic
1168348906 19:55664609-55664631 GGAACTGAGTCAGCTCTTCAGGG + Intronic
925712066 2:6750766-6750788 GGCACAGTGTAAGCTGTTGATGG + Intergenic
926060217 2:9800401-9800423 GGAGCTGTGGCAGCTGTGCCGGG + Intergenic
928225979 2:29448539-29448561 ATATCAGTGTCTGCTGTTCCAGG - Intronic
929028476 2:37628175-37628197 CTATCAGTGTCAGCTGGTCCTGG - Intergenic
929126268 2:38524910-38524932 TGAACAGTGTCAGTTGCTCAGGG + Intergenic
929331669 2:40689770-40689792 GGAACAGTATCAGCAGCCCCAGG - Intergenic
929576446 2:43055667-43055689 GGATCAGGGTCAGGTGCTCCTGG + Intergenic
930240168 2:48927987-48928009 GGAACAGTGTGAGGTGTGACAGG - Intergenic
933629129 2:84636326-84636348 GGAACAGGGGCAGCCATTCCAGG - Intronic
935575442 2:104704988-104705010 GGAACGATGACAGCAGTTCCTGG - Intergenic
941946916 2:171109420-171109442 GGAACAGTTACAGCAGTTCCTGG + Intronic
945591500 2:211738136-211738158 GGAACAGTATCAGTTATTCTTGG - Intronic
945622599 2:212159770-212159792 AGAACAGTGTCAGCAATTGCTGG - Intronic
945971782 2:216237954-216237976 GGAACAGTGGCAGGTGGTCATGG + Intergenic
946498051 2:220216042-220216064 GGTTAAGTGGCAGCTGTTCCTGG + Intergenic
1168897829 20:1336128-1336150 GGAACTGTGTCAGCAGATCAGGG - Intronic
1169881863 20:10355409-10355431 GTAACACTGTCATCTGTACCAGG - Intergenic
1170500100 20:16966677-16966699 GGACCATTGGGAGCTGTTCCTGG + Intergenic
1172342978 20:34173367-34173389 GGGAAAATGTAAGCTGTTCCTGG - Intergenic
1172629094 20:36366390-36366412 GGAGCAGTGACACCTGTTCAGGG + Intronic
1172669804 20:36627175-36627197 GGAACAGTGGAAGCTGTGGCTGG + Intronic
1173338770 20:42135679-42135701 TGAAAAGTGTAAGATGTTCCAGG + Intronic
1173746662 20:45442664-45442686 GGAAAGGGGTCAGCAGTTCCTGG + Intergenic
1174379249 20:50146215-50146237 GGAACAGTGTCAGGTGCACAGGG - Intronic
1174397027 20:50253072-50253094 TGGACAGTGTCAGCTGTCCTTGG + Intergenic
1175274564 20:57759324-57759346 GGAACAGCTTCAGCTGTCCATGG + Intergenic
1176332125 21:5558797-5558819 GGACCAGTGTGAGGTGTTCTGGG - Intergenic
1176395632 21:6262154-6262176 GGACCAGTGTGAGGTGTTCTGGG + Intergenic
1176441525 21:6726950-6726972 GGACCAGTGTGAGGTGTTCTGGG - Intergenic
1176465787 21:7054019-7054041 GGACCAGTGTGAGGTGTTCTGGG - Intronic
1176489348 21:7435797-7435819 GGACCAGTGTGAGGTGTTCTGGG - Intergenic
1178535189 21:33404409-33404431 GGAAGAGTGTCAACTGAGCCAGG + Intronic
1179379878 21:40888492-40888514 AGAAAAGTGTCAGCAATTCCTGG + Intergenic
1179398401 21:41061875-41061897 GGCACAGAGGCTGCTGTTCCAGG - Intergenic
1182369240 22:29799300-29799322 GGATCAGTGGCCGCTATTCCAGG - Intronic
1184057382 22:42061455-42061477 GGAACAGTGAACTCTGTTCCAGG + Intronic
1184286202 22:43473156-43473178 GGAAAAGGCTCTGCTGTTCCTGG + Intronic
1185310136 22:50149791-50149813 GGAACAGTCACAGCTGTACAGGG + Intronic
953049027 3:39323772-39323794 TGAAAAGTGTCAACTGTGCCAGG - Intergenic
955921392 3:63960316-63960338 GGCCCAGTGTCATCTGGTCCTGG - Intronic
956361620 3:68454156-68454178 AGAATAGTGGCAGCTTTTCCAGG + Intronic
957234166 3:77563251-77563273 AGAACAGTGTCACCTTGTCCTGG + Exonic
958798348 3:98730448-98730470 GGAACAGAGTCAGGTGGTCTAGG - Intergenic
964331372 3:155607015-155607037 GTAACAGTGTCTGCTTTTCCTGG + Intronic
964697578 3:159526890-159526912 GGGACAGTATCAGATGGTCCTGG - Intronic
967939221 3:194753625-194753647 GGAAGAGGGTCAGCAGTGCCAGG + Intergenic
968040520 3:195585140-195585162 GGAAAAGTGTCATCTGATCAGGG - Intergenic
969340249 4:6535805-6535827 GGCACAGGGACAGCTTTTCCTGG + Intronic
976380691 4:84394948-84394970 GGAACAGTGTGAGCTTTCCCTGG + Intergenic
984095685 4:175429816-175429838 GAAACAGTGACAGCTGTCTCAGG + Intergenic
984316591 4:178138355-178138377 GGAACAGTGTGTGCTGGTCCTGG + Intergenic
986043136 5:4012279-4012301 TGAGCAGAGTCAGCTGGTCCAGG + Intergenic
987075455 5:14378082-14378104 GGACCAGTGTCAGCAGTACGTGG + Exonic
988580975 5:32468557-32468579 GGAACAAAGTCAGCTCTTCAGGG + Intergenic
990810535 5:59717252-59717274 GGAATGGTGGCAGCTTTTCCAGG - Intronic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
997599636 5:135130497-135130519 GGATCAGTGTCCACAGTTCCTGG + Intronic
1004068291 6:12272962-12272984 AGATCAGTGACAGCAGTTCCAGG - Intergenic
1005996760 6:30936244-30936266 GGCACAGTTGGAGCTGTTCCGGG - Intergenic
1006572452 6:35017020-35017042 GGAAATGTATCAGATGTTCCAGG + Intronic
1006719040 6:36138366-36138388 GGATCTGGGTCAGCTGGTCCAGG - Exonic
1007130849 6:39472087-39472109 GGAACGCTGACAGCTCTTCCAGG - Intronic
1007423086 6:41731325-41731347 GGACCAGTGTCACCTGGTCAGGG - Intronic
1010462949 6:76133974-76133996 GGCATCGTCTCAGCTGTTCCTGG - Intergenic
1012991354 6:105929820-105929842 GGAACATTATCATCTGTTCCTGG - Intergenic
1013365828 6:109437257-109437279 GGAAAAGTGACAGCTGCTGCAGG + Intronic
1013367093 6:109444752-109444774 GAAACAGTGGCAGCTGGACCAGG - Exonic
1017723425 6:157260260-157260282 GGAAAAGTGTCAGAGGCTCCAGG + Intergenic
1019609211 7:1928473-1928495 GGAACAGTCTCAGGTGTGGCAGG - Intronic
1020521163 7:9189279-9189301 AGAACACAGTGAGCTGTTCCAGG + Intergenic
1021160874 7:17271548-17271570 TGCACAGTGTCAGTTGTTGCTGG + Intergenic
1021406488 7:20273678-20273700 GGGACAATGCCAGCTGTTTCTGG - Intergenic
1023648142 7:42340754-42340776 TGAAAAGTGTGAGCTGCTCCTGG + Intergenic
1027687497 7:81295376-81295398 GGAGCAGTCCCACCTGTTCCTGG + Intergenic
1029853478 7:103489286-103489308 AGAACAGTGGCAGCTGCTGCTGG + Intronic
1031634938 7:124091172-124091194 GGAATAATGTCAGGTTTTCCTGG - Intergenic
1034049836 7:147970823-147970845 GGAAAAGTGACAGATGTTTCAGG + Intronic
1034457721 7:151180341-151180363 AGGACAGTGGCAGCTGTTCTGGG + Intronic
1034984358 7:155498151-155498173 GGATCTGGGTCAGCTGTGCCTGG - Intronic
1035570658 8:670541-670563 GGGACAGTGTCATCTGCTTCTGG + Intronic
1037406246 8:18545854-18545876 GGGACAGGGTCAGTTCTTCCAGG + Intronic
1038348588 8:26755584-26755606 GGAACAGAAACAGTTGTTCCAGG - Intronic
1039221846 8:35340335-35340357 GGAACACTGTAAGCTGTTGAGGG + Intronic
1039270816 8:35878096-35878118 GGACCAGTGGCAGATGCTCCTGG - Intergenic
1039412981 8:37371175-37371197 GAAGCAGTGTCAGTTGCTCCAGG + Intergenic
1040560482 8:48519484-48519506 GGAAAAATGTAACCTGTTCCAGG + Intergenic
1041008187 8:53515962-53515984 GGAGCAGAGGCAGGTGTTCCCGG - Intergenic
1041539543 8:58967462-58967484 GGAACAGTGTCAGCTGTTCCTGG - Intronic
1043185858 8:77148680-77148702 GTAACAGTGTCAGCTATAACAGG - Intergenic
1044108771 8:88245528-88245550 GGAATACTGTCAGGTTTTCCTGG + Intronic
1044228164 8:89743081-89743103 GGAACAGTGTCCTGTGTTCATGG + Intergenic
1046484552 8:114869644-114869666 GGAACAGGGGCAGATGTTGCAGG - Intergenic
1046917442 8:119692343-119692365 GGCACAGTGCAAGCTGTTCGTGG - Intergenic
1049467292 8:142757422-142757444 GGAACAGTGCCAGCTCCTACAGG - Intergenic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1053377273 9:37618307-37618329 GGAACAGTGCTGGCTGTTACAGG + Intronic
1055828780 9:80357337-80357359 GGAACATTGAAAGCTGTACCAGG - Intergenic
1056050015 9:82758465-82758487 AAATCAGTGTCAGCTGTCCCAGG + Intergenic
1056201670 9:84282981-84283003 GGAACAAGGACAGCTTTTCCAGG - Intronic
1058485692 9:105441431-105441453 GGTACTGTGTCAGCACTTCCGGG - Intergenic
1059779322 9:117509289-117509311 GAAACAGCATCAGCTGTACCAGG - Intergenic
1061304542 9:129724770-129724792 GGGCCAGTGGGAGCTGTTCCCGG + Intergenic
1203429973 Un_GL000195v1:81535-81557 GGACCAGTGTGAGGTGTTCTGGG + Intergenic
1186028795 X:5344646-5344668 GGAACAGAGTCAGCTCTTTGTGG - Intergenic
1186103880 X:6185191-6185213 GAAAGAGTGACCGCTGTTCCAGG + Intronic
1186991692 X:15076469-15076491 GGAACATTGGCAGTTGTTTCTGG - Intergenic
1187223581 X:17354281-17354303 GGAATAGTGTCAGCAATTCTGGG - Intergenic
1188916562 X:35918871-35918893 GGAACCTTGTTAACTGTTCCAGG - Intergenic
1189490581 X:41468681-41468703 GGAACAGTGTTAGCTATTGTGGG + Intronic
1189711320 X:43815438-43815460 CTACCAGTGTCAGCTTTTCCAGG + Intronic
1197728527 X:129792268-129792290 GGCACTGTCTCAGCTGTTCTAGG + Intronic