ID: 1041545735

View in Genome Browser
Species Human (GRCh38)
Location 8:59040430-59040452
Sequence TACTGCTGTACCTAATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041545735_1041545739 1 Left 1041545735 8:59040430-59040452 CCCTCAAATTAGGTACAGCAGTA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1041545739 8:59040454-59040476 CCTCCCACCCTGCCAATCATGGG No data
1041545735_1041545737 0 Left 1041545735 8:59040430-59040452 CCCTCAAATTAGGTACAGCAGTA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1041545737 8:59040453-59040475 ACCTCCCACCCTGCCAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041545735 Original CRISPR TACTGCTGTACCTAATTTGA GGG (reversed) Intronic
903296667 1:22348043-22348065 TTCTGTGGTACCTAGTTTGAGGG - Intergenic
908399189 1:63754349-63754371 TGCTGCTGTAACAAATTTGGTGG - Intergenic
910375291 1:86562293-86562315 TACTGCAGTAGCTGATATGAGGG + Intronic
911501549 1:98692586-98692608 TACTGCTACACCCAATTTAATGG + Intronic
911807257 1:102226039-102226061 TACTGGTTTACATAATTTGTTGG - Intergenic
922281226 1:224126326-224126348 TACTGCTGTAACAATTTTCAAGG - Intronic
923329999 1:232914425-232914447 TGCTCCTCTTCCTAATTTGAAGG - Intergenic
1063799637 10:9559649-9559671 TACTGCAATATCAAATTTGATGG + Intergenic
1070387371 10:75938066-75938088 TACTGCTACAGCTAACTTGAAGG + Intronic
1086512529 11:87574681-87574703 GCCAGCTGTAGCTAATTTGATGG + Intergenic
1088542228 11:110925126-110925148 TATTTTTGTTCCTAATTTGAGGG - Intergenic
1090320223 11:125836703-125836725 TACAACTGTACATAATTTGGAGG + Intronic
1092507455 12:9118450-9118472 TACTGCTGTAGCTCATCAGATGG + Intergenic
1094244959 12:28279342-28279364 GACTTCTGTACTTAACTTGAGGG - Intronic
1098087783 12:66866066-66866088 TATTGATGTCCCCAATTTGATGG + Intergenic
1099351833 12:81580989-81581011 TAATGGTGAACCTAAATTGAGGG + Intronic
1099544988 12:83967575-83967597 TGCTTCTATACCTAATTTGTTGG - Intergenic
1105669855 13:22600882-22600904 TAATTCTGTACCTTATTTCAGGG - Intergenic
1108478632 13:50844396-50844418 TACAGCTGTCCCTAAGTTCATGG - Intergenic
1108866822 13:54933924-54933946 GACAGCTGTAGTTAATTTGAGGG + Intergenic
1109915486 13:68980125-68980147 TCCTTCTATGCCTAATTTGAAGG + Intergenic
1111034427 13:82653708-82653730 TACTGCTTTTCCTAATTTTCAGG - Intergenic
1117197515 14:53355232-53355254 TACTGCTTTGCGTAATTTCAGGG - Intergenic
1128788758 15:70417300-70417322 TACTGCCTTACATTATTTGAGGG + Intergenic
1130641669 15:85681965-85681987 TACTTCTGGTTCTAATTTGAGGG + Intronic
1138251740 16:55507007-55507029 TACTGCTGAACAGAAATTGAAGG + Intergenic
1138955125 16:61962316-61962338 GCCTGCTGTACCTCATCTGAGGG - Intronic
1149813619 17:59702412-59702434 TAATGCTGTCGCTAATTAGACGG + Intronic
1151251571 17:72839791-72839813 TACTTCTGTGCATAAGTTGAGGG + Intronic
1155527788 18:26734936-26734958 CAGTGCTGTACCTCATTAGAGGG - Intergenic
1157207284 18:45711371-45711393 TCCTGCTGTACTGAACTTGATGG + Intergenic
929026487 2:37609040-37609062 TACTTCTATACCTAATTTGTTGG - Intergenic
929191967 2:39148417-39148439 TAATGCTGTATCTATTTGGAAGG + Intergenic
929901698 2:46009739-46009761 AACTGAAGTGCCTAATTTGAGGG + Intronic
930613525 2:53569581-53569603 TACTGCTGTATCTAAAATTATGG - Intronic
932859550 2:75275486-75275508 TACTGTTGTACCTTAGGTGATGG - Intergenic
937997185 2:127703052-127703074 AACTGCTGAACCTAAAATGAAGG - Exonic
940132914 2:150404645-150404667 TATTGCTATACCAAATTAGAAGG + Intergenic
940247023 2:151630375-151630397 TACTGATGTATCTAATTGGTAGG + Intronic
941413615 2:165191211-165191233 TACTGCTGTAAATCATTTCAAGG - Intronic
941765415 2:169291337-169291359 TAATTCTGGACCTAACTTGATGG - Intronic
942970055 2:181947772-181947794 TCTTGCTGAAACTAATTTGAGGG + Intergenic
944326853 2:198416000-198416022 GACTGGTGTACCTAATTCCATGG - Intronic
945193093 2:207210481-207210503 TTCTTCTTTACCTATTTTGATGG - Intergenic
1170094066 20:12625684-12625706 AAGTTCTGTACCTAATTTGTTGG + Intergenic
1179269454 21:39839501-39839523 TTCTACTGTCCCTAATTTGTGGG + Intergenic
1182379500 22:29875588-29875610 TTCTCCTATACCTAATTTGTTGG + Intergenic
1184261527 22:43319972-43319994 TACAGGTGTACCTGCTTTGATGG - Exonic
950923576 3:16718120-16718142 TACTGATATACCTACTCTGATGG - Intergenic
950990379 3:17431032-17431054 TACTACTGAATCTAATTTGGAGG + Intronic
951060933 3:18206484-18206506 TAATGCTGTACCTATCTTGGTGG + Intronic
952583378 3:34862428-34862450 TACCTCTGGACCTAATTTAATGG + Intergenic
956327062 3:68065117-68065139 TTCTGATCTCCCTAATTTGAGGG - Intronic
957851825 3:85818134-85818156 TAGTGCTGTAACTACATTGAGGG + Intronic
960014169 3:112867668-112867690 TTCTTCTGTACCTATTTTGATGG + Intergenic
960329870 3:116345758-116345780 CACTGCTATATCTAATTTTAGGG - Intronic
962555311 3:136544359-136544381 TACTTGTGTACCTAGTTGGAGGG - Intronic
963625105 3:147661452-147661474 GTCTGCTGTTCATAATTTGATGG + Intergenic
964020470 3:152004455-152004477 GCCTGTTGTACCTAATTTTAGGG + Intergenic
966449191 3:180037970-180037992 TCATGCTGTACATAATATGAGGG - Intergenic
967538385 3:190634557-190634579 TAATGCTGTGACTAATGTGAGGG + Intronic
974700804 4:65443418-65443440 TACTGCGATACCGAATTAGATGG + Intronic
977895456 4:102359782-102359804 AAATGCAGTATCTAATTTGAAGG + Intronic
979379007 4:119986054-119986076 TACTGCTGTATCAAATTTTTTGG - Intergenic
982311712 4:153992957-153992979 TCCTTCTATACCTAATTTGTTGG + Intergenic
989508993 5:42261544-42261566 TCCTTCTATACCTAATTTGTTGG - Intergenic
989617200 5:43348973-43348995 GACTGATTTACCTAATTTAAGGG + Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
993873540 5:93279631-93279653 CAGTGCTGTTTCTAATTTGAAGG + Intergenic
995313831 5:110743820-110743842 TACTTCTGACCCTAATATGAAGG + Intronic
995645888 5:114310896-114310918 TAGTGCTGTACCTCATTTCCTGG - Intergenic
1000468080 5:161605116-161605138 AATTACTGTACCTAAGTTGAGGG + Intronic
1004476185 6:15974738-15974760 TACTGCTGTAGCCATTTTGGGGG - Intergenic
1008583803 6:52930624-52930646 TACCTCTGTTCCTGATTTGAAGG + Intergenic
1014888021 6:126805803-126805825 TATTGCTTTACTTAATTTGGGGG + Intergenic
1017194991 6:151690477-151690499 TACTGCATTTCCTAATTTCATGG + Exonic
1019655264 7:2190677-2190699 TACTCATGTACTTAACTTGACGG - Intronic
1020876938 7:13709077-13709099 TGCTGCCATACCTAATTTCAGGG - Intergenic
1020918489 7:14230536-14230558 TATTGCTCTATCTTATTTGATGG - Intronic
1021142353 7:17042992-17043014 TAAGGCTGTAGCTAATTTGAAGG - Intergenic
1021899720 7:25272590-25272612 TACTGCTGAAAGTAATTGGATGG + Intergenic
1022213596 7:28236270-28236292 TCCTGTTGTACCTCATTTTACGG - Intergenic
1028727057 7:94100026-94100048 TACTGCTTTACATAATTAGAAGG - Intergenic
1033101489 7:138476616-138476638 TAATGCTGTACCTATTTTGGGGG - Intronic
1033849578 7:145479028-145479050 TTCTGATGAACCAAATTTGAGGG - Intergenic
1033979025 7:147140768-147140790 TAATGCTGTACATAATTTTATGG + Intronic
1040610711 8:48978628-48978650 AAATGTTGTACATAATTTGAAGG + Intergenic
1041367430 8:57123437-57123459 TACAGCTATACCTATTTTAATGG - Intergenic
1041545735 8:59040430-59040452 TACTGCTGTACCTAATTTGAGGG - Intronic
1041691312 8:60690695-60690717 TACTGCTGTAGCTGAATTGCTGG + Intronic
1041984475 8:63905517-63905539 TTCAGATGTATCTAATTTGATGG - Intergenic
1042721437 8:71830874-71830896 TTCTGCTGTACATAATCTGATGG - Intronic
1047833757 8:128664737-128664759 TGCTGCTGCACTTAATTTAATGG + Intergenic
1051384545 9:16493817-16493839 TACTGCTGCATCTATTTAGATGG - Intronic
1051910161 9:22145221-22145243 TACTTCTTTACATATTTTGATGG - Intergenic
1051989492 9:23134944-23134966 CACTGTTGTACCTATTTTGGGGG + Intergenic
1052530573 9:29679084-29679106 TAATGGTGGACCTAATTTGTGGG + Intergenic
1055795037 9:79966971-79966993 TGCTGCTGTACCTAATGAAAGGG + Intergenic
1058103540 9:100943738-100943760 TCCTTCTGTACCAAATTTGTTGG + Intergenic
1058361517 9:104152175-104152197 TTCTGCTATACCTCAGTTGAGGG - Intergenic
1060924355 9:127445636-127445658 TCCTGCTGCCCCAAATTTGATGG - Intergenic
1062297768 9:135842372-135842394 GACTGATGTACCTAAAGTGACGG + Intronic
1188705752 X:33327728-33327750 TACTTCTGTACCTGCTTGGAAGG - Intronic
1188758313 X:33992903-33992925 TGTTGCTTTACTTAATTTGAGGG + Intergenic
1192465276 X:71350682-71350704 TACTTCGGGACCTAAATTGAGGG + Intergenic
1192473013 X:71415800-71415822 TACTTCGGGACCTAAATTGAGGG - Intronic
1197557936 X:127979257-127979279 TCCTGCTATACCTAGTTTGTTGG - Intergenic
1201715669 Y:17042396-17042418 TTGTGCTGAACCTAATTTGTAGG - Intergenic