ID: 1041548075

View in Genome Browser
Species Human (GRCh38)
Location 8:59069068-59069090
Sequence AGCACTGCTGTCCCAACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041548075_1041548078 14 Left 1041548075 8:59069068-59069090 CCAGGAGTTGGGACAGCAGTGCT 0: 1
1: 0
2: 1
3: 34
4: 284
Right 1041548078 8:59069105-59069127 AGAGTTGACAGCAAGACGGATGG No data
1041548075_1041548079 15 Left 1041548075 8:59069068-59069090 CCAGGAGTTGGGACAGCAGTGCT 0: 1
1: 0
2: 1
3: 34
4: 284
Right 1041548079 8:59069106-59069128 GAGTTGACAGCAAGACGGATGGG No data
1041548075_1041548077 10 Left 1041548075 8:59069068-59069090 CCAGGAGTTGGGACAGCAGTGCT 0: 1
1: 0
2: 1
3: 34
4: 284
Right 1041548077 8:59069101-59069123 CAAGAGAGTTGACAGCAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041548075 Original CRISPR AGCACTGCTGTCCCAACTCC TGG (reversed) Intronic
900542788 1:3212451-3212473 ACCTCTGCTGTCCCTACTGCAGG - Intronic
900955339 1:5883247-5883269 AGCACTGATGTTCACACTCCGGG + Intronic
901202336 1:7473740-7473762 AGCCCTCCTGGCCCAGCTCCAGG + Intronic
901866357 1:12109544-12109566 GGCACTGCTGTCCCCCCTGCAGG + Exonic
905172973 1:36119870-36119892 GGCACTGCTGGCCCAGCTCATGG + Intronic
905173308 1:36121902-36121924 GGCACTGCTGGCCCAGCTCATGG - Intronic
906526586 1:46496821-46496843 AGGGCTCCTGCCCCAACTCCAGG - Intergenic
907261707 1:53223018-53223040 GTCACTCCTCTCCCAACTCCAGG + Intergenic
908088096 1:60658252-60658274 ATCACTGCTTTGCCAACTGCAGG + Intergenic
909196223 1:72627751-72627773 AGCACTCGTCTCACAACTCCTGG - Intergenic
911885403 1:103291350-103291372 AGAAGTGGTGTCCCATCTCCAGG - Intergenic
911975613 1:104490134-104490156 ATCATTCCTGCCCCAACTCCTGG + Intergenic
912466907 1:109880738-109880760 GGAACTGGTGTCCCAAGTCCCGG - Intergenic
912902406 1:113666503-113666525 AGCAATTCAGTCCCAACTTCAGG + Intronic
912946316 1:114087652-114087674 AGCCCTGCTGTCCCCAGCCCTGG - Intergenic
915415553 1:155739924-155739946 CTCACTGCAGCCCCAACTCCTGG + Intergenic
917196644 1:172473266-172473288 AGCCTTGCTGTCCCAAATTCAGG - Intergenic
920056476 1:203196638-203196660 AACACAGCTGTCCCACATCCAGG - Intergenic
920338324 1:205259636-205259658 AGCACCGGTGTCCCATGTCCAGG + Intronic
921955778 1:220981993-220982015 AGCACTGGAGTCCCGGCTCCAGG + Intergenic
922396299 1:225204767-225204789 ACCATTGCTTTCCCCACTCCAGG + Intronic
922823292 1:228499469-228499491 AGCAATTCAGTCCCATCTCCAGG + Intergenic
924088078 1:240474652-240474674 ATCAGTGCTTTCCCAACTCTTGG + Exonic
924353378 1:243142341-243142363 AGCACTGCTGCCACCACCCCTGG - Exonic
924703487 1:246478370-246478392 AGCACTTATGTACCAGCTCCAGG - Intronic
924703492 1:246478417-246478439 AGCACTTATGTACCAGCTCCAGG - Intronic
924703503 1:246478511-246478533 AGCACTTATGTACCAGCTCCAGG - Intronic
924703508 1:246478558-246478580 AGCACTTATGTACCAGCTCCAGG - Intronic
924703535 1:246478792-246478814 AGCACTTATGTACCAGCTCCAGG - Intronic
924703541 1:246478839-246478861 AGCACTTATGTACCAGCTCCAGG - Intronic
924703547 1:246478886-246478908 AGCACTTATGTACCAGCTCCAGG - Intronic
924703553 1:246478933-246478955 AGCACTTATGTACCAGCTCCAGG - Intronic
924703566 1:246479074-246479096 AGCACTTATGTACCAGCTCCAGG - Intronic
924703571 1:246479121-246479143 AGCACTTGTGTACCAGCTCCAGG - Intronic
1065672449 10:28135190-28135212 AGCTCTGTTTTCCCAACTCAAGG - Intronic
1066095547 10:32068785-32068807 AGCACTGCCATCCCTGCTCCAGG - Intergenic
1067078290 10:43200296-43200318 TGCAGTGCTGTCCCTTCTCCAGG - Intronic
1067151196 10:43736274-43736296 AGAACTGCTGTCCCCTCACCAGG + Intergenic
1068607282 10:59019792-59019814 AGTACTGCTTTCCAAACTCCAGG - Intergenic
1068865475 10:61890238-61890260 GACACTGCGGTCCCAACCCCAGG - Intergenic
1071120573 10:82272316-82272338 AACACTCCTTTCCAAACTCCTGG - Intronic
1071306999 10:84308251-84308273 CACACTGTGGTCCCAACTCCTGG + Intergenic
1071611693 10:87037986-87038008 AACACTGAGCTCCCAACTCCTGG + Intergenic
1071672264 10:87619492-87619514 TTCACTGCTGCCCCAACTCCTGG - Intergenic
1072492210 10:95919519-95919541 ATCACTCCTTCCCCAACTCCAGG - Intronic
1072557780 10:96536868-96536890 AGCACTACAGCCTCAACTCCTGG + Intronic
1073178410 10:101570091-101570113 AGCTCCGCTGTCTCAGCTCCCGG + Intergenic
1073438345 10:103535980-103536002 AGCACTGCTGTGTGGACTCCAGG + Intronic
1074233036 10:111556503-111556525 AGCTGTGCTTTCACAACTCCAGG - Intergenic
1074852750 10:117451838-117451860 AACACTGCTGTCCCCATTCCTGG - Intergenic
1075654576 10:124152635-124152657 AGCTGTGCTGGCCCCACTCCAGG - Intergenic
1076803903 10:132845753-132845775 GGCACTGCTGGCCCATCTGCTGG + Intronic
1077128936 11:959711-959733 ACCAGTGCTGTTCCAGCTCCAGG - Intronic
1077424799 11:2470033-2470055 CTCACTGCAGTTCCAACTCCTGG + Intronic
1077560109 11:3255014-3255036 AGCACAGCTCTCTCAGCTCCTGG + Intergenic
1077566002 11:3300817-3300839 AGCACAGCTCTCTCAGCTCCTGG + Intergenic
1079075590 11:17383693-17383715 TGCAGAGCTGTCTCAACTCCAGG - Intergenic
1083849482 11:65356561-65356583 GGCCCTGCTGTCCCATGTCCCGG - Exonic
1083887493 11:65580039-65580061 AGCACTGATGCCCCTTCTCCTGG + Intronic
1084359972 11:68662834-68662856 AGAACTGTTGTCCAGACTCCTGG - Intergenic
1084970266 11:72767723-72767745 AGCACTGCTGTATGAACTCTGGG - Intronic
1085686865 11:78631373-78631395 ATCACCCCTCTCCCAACTCCAGG - Intergenic
1085789315 11:79483259-79483281 AGCAATTCTGTCCCAACAGCAGG + Intergenic
1086131853 11:83409471-83409493 AGCCCTTCTGTGCCCACTCCAGG + Intergenic
1089288128 11:117420542-117420564 AGCACTGGGCCCCCAACTCCTGG - Intergenic
1090468721 11:126959091-126959113 AACACTGGTGTCCCAGCTCAAGG - Intronic
1092030098 12:5276769-5276791 AGCTCTGCTCTCCCACCTGCAGG + Intergenic
1094406640 12:30123237-30123259 ACTACTGCATTCCCAACTCCTGG - Intergenic
1097984372 12:65768199-65768221 AGTAATGCTATACCAACTCCAGG + Intergenic
1100157626 12:91819338-91819360 TGCACTGCAGTGCCAGCTCCAGG - Intergenic
1100681065 12:96921731-96921753 CTCACTGCAGCCCCAACTCCTGG + Intronic
1101438696 12:104686350-104686372 AGCACAGCTGTCCCACATTCTGG - Intronic
1102445857 12:113002332-113002354 AGCACAGCTGTGCCAAAACCTGG + Intronic
1104757282 12:131277102-131277124 AACACTGGTGTCCCGAGTCCTGG - Intergenic
1104757294 12:131277161-131277183 AACACTGGTGTCCCGAGTCCTGG - Intergenic
1104757306 12:131277220-131277242 AACACTGGTGTCCCGAGTCCTGG - Intergenic
1104757346 12:131277398-131277420 AGGACTGGTGTCCCGAGTCCTGG - Intergenic
1104775700 12:131389076-131389098 AGGACTGGTGTCCCGAGTCCTGG + Intergenic
1108890016 13:55245311-55245333 ATCAGCCCTGTCCCAACTCCAGG + Intergenic
1111568689 13:90049072-90049094 ACCACTCCTGCCCCAACTCCAGG - Intergenic
1113262173 13:108576833-108576855 TTCACTGCAGCCCCAACTCCTGG + Intergenic
1113704168 13:112415200-112415222 ATCACTCCTCTTCCAACTCCAGG - Intronic
1114613059 14:24054602-24054624 AGCTCTCATGTCCCCACTCCTGG + Intronic
1115173387 14:30533766-30533788 TGCACTGCAGCCCAAACTCCTGG - Intergenic
1117231354 14:53722446-53722468 AGCAATTCAGTCCCACCTCCAGG - Intergenic
1118010719 14:61608002-61608024 AGCACTGCTGAGCCTTCTCCTGG + Intronic
1118859730 14:69653272-69653294 AGTGCTGCTGCCCCAACACCTGG - Intronic
1119466879 14:74865174-74865196 AACACTGCCGTCCTAACTCTTGG + Intronic
1119709548 14:76812174-76812196 AGCATTCCTGCCCCCACTCCCGG - Intronic
1122023829 14:98860079-98860101 AGTACTGCTGCCCCATCTCATGG + Intergenic
1122229598 14:100299118-100299140 AGCACTGGTGTCCCATCTGCAGG + Intronic
1122556847 14:102585223-102585245 GGCCCTGGTGTCCCCACTCCTGG - Intergenic
1122701771 14:103594405-103594427 AGCACTGCTGCCCCAAGGCAAGG - Intronic
1122717038 14:103702108-103702130 AGCACTGCTGCCCCAGCTGCAGG + Intronic
1122727460 14:103767447-103767469 TGCAATGGTGTCACAACTCCTGG - Intronic
1122804364 14:104249170-104249192 GGCACAGCTGCCCCACCTCCAGG - Intergenic
1123410945 15:20058553-20058575 GTCACTCCTGTCCCAACGCCAGG - Intergenic
1123520275 15:21065241-21065263 GTCACTCCTGTCCCAACGCCAGG - Intergenic
1124466836 15:29947891-29947913 AGCACAGCTGTGCCAACCCTGGG + Intronic
1126233500 15:46354633-46354655 AACACAGCTGCCCCACCTCCTGG + Intergenic
1128789567 15:70423186-70423208 AGCCCTGCTTTCCCATCCCCAGG + Intergenic
1129314162 15:74731180-74731202 AGCACTTCTGCCCCTGCTCCTGG - Intergenic
1130340055 15:82992569-82992591 AGCTATACTGTCCCAACTACTGG - Intronic
1130354648 15:83118150-83118172 CTCACTGCAGTCTCAACTCCTGG - Intronic
1131934870 15:97492211-97492233 AGCCCAGCTCTCCTAACTCCAGG + Intergenic
1132199954 15:99944487-99944509 AGCACAGCTGTGTGAACTCCAGG + Intergenic
1132513349 16:354512-354534 AGCACAGAAGTCCCAGCTCCAGG + Intergenic
1133026539 16:2991176-2991198 AGCCCAGCTCTCCCAGCTCCTGG - Intergenic
1133330050 16:4967251-4967273 AGTTCTGCTGTCCCAAGTCAAGG - Intronic
1133415773 16:5605873-5605895 ACAGATGCTGTCCCAACTCCAGG + Intergenic
1134108859 16:11502141-11502163 GACACTGGTGTCCCAGCTCCAGG - Exonic
1136060906 16:27725827-27725849 CTCACTGCTGTCCCACTTCCTGG - Intronic
1137254565 16:46764307-46764329 AGCACTGCAGCCTCAACTCCTGG - Intronic
1137393111 16:48097823-48097845 AGCAATGCTGGCAGAACTCCTGG + Intronic
1138283404 16:55789778-55789800 AGCTCTCCTGTCCCAGCCCCAGG - Intergenic
1138285597 16:55807209-55807231 AGCTCTCCTGTCCCAGCCCCAGG + Intronic
1138292468 16:55859743-55859765 AAATCTGCTGTCCCAAATCCTGG + Intronic
1138440033 16:57028654-57028676 CGCACTGCTATCCCTTCTCCTGG - Intronic
1139059077 16:63226425-63226447 AGCAATGCAGTCACATCTCCAGG + Intergenic
1141423167 16:83930333-83930355 AGCACTGCTTCCCCACCCCCAGG - Intronic
1142680345 17:1544029-1544051 GGCACTGCTGCCCCCACTCCAGG - Intronic
1142809793 17:2390220-2390242 AAGAGTGCTGTCCCGACTCCTGG + Intronic
1143742865 17:8966598-8966620 AGCACTGCTGTTCCAGCCTCTGG + Intergenic
1144055308 17:11535286-11535308 AGCACTCATTGCCCAACTCCTGG + Intronic
1144262793 17:13539210-13539232 AGCAATGTTGTGCCAACTCCAGG - Intronic
1144505735 17:15828991-15829013 AGCACTGCTCCCCCAGCTGCAGG + Intergenic
1145169910 17:20646923-20646945 AGCACTGCTCCCCCAGCTGCAGG + Intergenic
1146725108 17:35149971-35149993 AGCCCCACTGCCCCAACTCCAGG - Intronic
1148741905 17:49897826-49897848 AGCACTCCTGTCCCACCTCCTGG + Intergenic
1148896644 17:50842855-50842877 GGCACTGCTGTCCCCATTCTGGG - Intergenic
1149400775 17:56293862-56293884 AGCACCTCTGTCCCTTCTCCAGG + Intronic
1150380843 17:64718172-64718194 AGCACTGCTGCACCTGCTCCAGG - Intergenic
1150775658 17:68079939-68079961 AGCACTGCTGCCCCTGCTCCAGG + Intergenic
1150810205 17:68350298-68350320 AACACAGCTCTCCCTACTCCTGG + Intronic
1151949087 17:77339027-77339049 AGCAATCCAGTCCCATCTCCAGG + Intronic
1152759317 17:82099681-82099703 CGCACTGCTGTCCCCACTGCGGG + Intergenic
1152813768 17:82394929-82394951 AGAGCTGTTGACCCAACTCCGGG + Intronic
1156453465 18:37279728-37279750 AGAACTGCTGTCCCTGCACCTGG + Intronic
1157211724 18:45748543-45748565 AGCACTGCTCTCCCTTCTCCTGG + Intronic
1158480666 18:57818770-57818792 AGCACTGCTGCCCCACCACCAGG + Intergenic
1159917489 18:74199801-74199823 CTCACTGCAGTCTCAACTCCTGG - Intergenic
1160778144 19:866139-866161 AGCTCTGCTGTCCCCGCCCCCGG - Intergenic
1161577433 19:5062189-5062211 AGCACTGAGGTCCCATATCCTGG - Intronic
1162730456 19:12715404-12715426 AGCACTGCAGTCCCAAGATCCGG - Exonic
1166889361 19:45981062-45981084 AGCACTGCTGTCTCACATCCTGG - Intergenic
1168417551 19:56178568-56178590 AGAGCTGCTATCCCAACTCAGGG - Intronic
925351951 2:3207331-3207353 TGCACTGCTGCCCCAGCTGCAGG + Intronic
925508017 2:4591002-4591024 AGCAATTCTGTCCCATCTTCAGG - Intergenic
925665677 2:6252716-6252738 AGCAGTGCTGTCCCTCCTCCAGG + Intergenic
926133809 2:10322670-10322692 AGAACAGCTGCCCCATCTCCAGG - Intronic
926621117 2:15048204-15048226 AGCCTTGCTGTCCCCACTGCAGG - Intergenic
927293341 2:21425677-21425699 AGAATTACTGTCCTAACTCCAGG + Intergenic
927293356 2:21425832-21425854 AGAATTACTGTCCTAACTCCAGG + Intergenic
928620832 2:33086022-33086044 ATCACTGATGTTCTAACTCCTGG - Intronic
929212128 2:39368593-39368615 CTCACTGCAGCCCCAACTCCTGG - Intronic
930342941 2:50140382-50140404 ACCACTGCAGTACCAACTTCAGG + Intronic
930760749 2:55032816-55032838 CAAACTGGTGTCCCAACTCCTGG - Intronic
933881951 2:86678454-86678476 AGGACTGCTTTCCCAAATTCTGG - Intronic
934887365 2:98036731-98036753 GTCCCTGCTGTCCCAGCTCCAGG + Intergenic
935121846 2:100189966-100189988 AGCAGTGCTGTCCCAACAGGTGG + Intergenic
936895691 2:117425019-117425041 AGCACTACTGTCCTACCTCCTGG - Intergenic
936913673 2:117617635-117617657 GGCACTGCAGTCCCAAGTCAGGG - Intergenic
938948901 2:136239398-136239420 TTTTCTGCTGTCCCAACTCCAGG - Intergenic
940492664 2:154384262-154384284 AGCACTGTTGTCTCAAATTCTGG + Intronic
941413280 2:165186958-165186980 AGCACCCCTGTCCCAACCCTAGG - Intronic
942059710 2:172216905-172216927 AGAACTGATGTCCCAGCTCAAGG + Intergenic
946009801 2:216555381-216555403 TGCAGTGCTGTGCCAACTTCTGG + Intronic
946199990 2:218065754-218065776 TGCACTGCTGACCCGCCTCCTGG - Intronic
948020598 2:234730199-234730221 AGCAATGCTGTGCCCACTCTGGG + Intergenic
948252116 2:236537521-236537543 AGAACTGCTGTTCAAACTTCAGG - Intergenic
948569815 2:238910877-238910899 ACCCCTGCTGTCCAAAGTCCGGG + Intergenic
948697738 2:239741782-239741804 AGCACACATGTCCCAGCTCCAGG + Intergenic
948774599 2:240277405-240277427 ACCACCCCTCTCCCAACTCCAGG + Intergenic
1169026016 20:2372155-2372177 ATGGCTTCTGTCCCAACTCCAGG + Intergenic
1169590151 20:7131758-7131780 AACCCTGCTCTCCCAAGTCCTGG - Intergenic
1173226670 20:41166211-41166233 AGCACTGCCGTATCCACTCCCGG + Exonic
1175771556 20:61627670-61627692 GGCACTGCTGTCCCAACCAGGGG - Intronic
1175894157 20:62328709-62328731 AGCATTGCTGCCCCATCTGCGGG - Intronic
1176154430 20:63611151-63611173 AGCACTGCTGTCCCCAGCCTGGG + Intronic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176262519 20:64189805-64189827 TGCACTGTTGTCCCAGCTCTAGG - Intronic
1179215298 21:39362192-39362214 TCCACTCCTGGCCCAACTCCAGG - Intergenic
1181507066 22:23366464-23366486 AAATCTGCTGTCCCAAATCCTGG + Intergenic
1181631816 22:24155666-24155688 GGCACTACTGGCACAACTCCAGG + Intronic
1182443109 22:30375615-30375637 ATCAATGCTGTCCAAAATCCGGG + Exonic
1183406074 22:37631288-37631310 AGGACTGCTGTACAAACTCCAGG + Intronic
1183549415 22:38472613-38472635 AGCACTGTTGACTGAACTCCAGG - Intronic
1184896169 22:47408124-47408146 AGCACAGCTGTCCACACTGCAGG - Intergenic
1185079583 22:48702304-48702326 AGCACTGCTGGCCCAGGGCCTGG + Intronic
950700450 3:14741937-14741959 ACCACTGCTGTGGCAACACCTGG - Intronic
952784034 3:37134563-37134585 GACAATGCTGTCCCACCTCCGGG + Intronic
953874817 3:46660707-46660729 GGCACCGCTGCCCCAGCTCCAGG + Intergenic
955614164 3:60788215-60788237 TGCACTGCAGTTCGAACTCCTGG - Intronic
958052209 3:88362899-88362921 ATCACTTCTCCCCCAACTCCAGG - Intergenic
958807066 3:98824042-98824064 TGCACTGCCGTCCCCACTTCCGG - Intronic
959944981 3:112116674-112116696 AGCAGTGCTCTACCAAGTCCTGG + Exonic
961354427 3:126327031-126327053 AGGACTGCTGGCTCAACTCCAGG + Intergenic
961431091 3:126883653-126883675 ATCACTGCTGTCCTCACTCTGGG + Intronic
962351383 3:134659050-134659072 AGCACTGCTTTCCAAATTTCGGG + Intronic
962355794 3:134693337-134693359 AGCTTTGCTGTCCTATCTCCAGG - Intronic
962676056 3:137759572-137759594 AGCACTGCTCTAACAGCTCCAGG + Intergenic
963945042 3:151136445-151136467 AGCACTTCTGTCCAATCTTCAGG - Intronic
965123857 3:164598524-164598546 AGAACTGCTGTCCCCCTTCCTGG - Intergenic
968164381 3:196452736-196452758 AGCCCTGTAGTCCCAGCTCCTGG + Intergenic
968920961 4:3522162-3522184 AGCACTGAGGTCCCACCCCCAGG + Intronic
968943067 4:3649176-3649198 AGCTCAACTGTCCCCACTCCCGG + Intergenic
969231068 4:5831638-5831660 TGGGCTGCTGTCCCTACTCCTGG + Intronic
969300797 4:6295787-6295809 AGCAGTGCGGGCCCTACTCCTGG + Intronic
969441226 4:7217901-7217923 AGCACAGCTGTCCCCTCTCCTGG - Intronic
969618012 4:8265022-8265044 TGCACTGCTGTCCCCACCCGTGG + Intergenic
970376929 4:15468162-15468184 AACACTGCTGCCCCAAATCCTGG + Intergenic
970464501 4:16309206-16309228 AACTCTGCTGTCAGAACTCCTGG - Intergenic
971187618 4:24395729-24395751 GGCATTGCTGTTCCAACTCACGG + Intergenic
972828269 4:42786498-42786520 AGCACATCTGCCCCACCTCCTGG - Intergenic
974530999 4:63107769-63107791 ATCACCCCTCTCCCAACTCCAGG + Intergenic
975361137 4:73473841-73473863 AGCACTCATCTCTCAACTCCTGG + Intergenic
976206909 4:82631330-82631352 AGCACTGCTGTCTCCAGTCCTGG + Exonic
978471178 4:109069336-109069358 ATGCCTGCTGTCCCAACTACTGG - Intronic
979159290 4:117438461-117438483 AGTACAGCTCTCCCAACACCTGG + Intergenic
979248559 4:118537961-118537983 AGCACTGCTGCCACCACCCCTGG + Intergenic
981337316 4:143581759-143581781 AGCACAGCTGCACCACCTCCTGG + Intronic
982165989 4:152614080-152614102 TGCACTGCTGGGCCACCTCCTGG + Intergenic
983886967 4:172990508-172990530 AGCACTGCTGGCTCAACAACAGG - Intronic
984366318 4:178804123-178804145 AGCACTGCTGCCTGACCTCCAGG - Intergenic
985493304 5:191577-191599 AGCTCTGGTGTCCCACCCCCAGG + Exonic
985642197 5:1068941-1068963 AGCAGGGCAGTTCCAACTCCGGG + Intronic
985969355 5:3362753-3362775 GGCACTGGTGTCCCTACTCCAGG - Intergenic
988135069 5:27159569-27159591 ATCACACCTTTCCCAACTCCAGG - Intergenic
988274553 5:29064202-29064224 AGCAATTCTGTCCCATCTTCAGG - Intergenic
992812630 5:80404999-80405021 CTCACTGCAGCCCCAACTCCTGG - Intergenic
993925581 5:93861423-93861445 ACCACTTCTGCCCCCACTCCAGG + Intronic
997417934 5:133743285-133743307 AGAAATGCTGTCCAAATTCCTGG - Intergenic
999897399 5:156049892-156049914 AGCACTTCAGTCACAGCTCCAGG - Intronic
1001940834 5:175738393-175738415 AGGAGTGCTGTCCCAGTTCCTGG + Intergenic
1002066961 5:176656696-176656718 AGCCCTGCTGCTCCAGCTCCTGG - Exonic
1003092446 6:3115374-3115396 AGCACTGCTGTCCCCGCGCCTGG + Intergenic
1006178049 6:32135209-32135231 CTCACTGCAGTCTCAACTCCTGG - Intergenic
1006808844 6:36806858-36806880 AGCACTGCTGTCCCACTTAAGGG + Intronic
1007119975 6:39371584-39371606 AGCATTGCTGTCCCTAGGCCTGG - Intronic
1007190012 6:40006048-40006070 ATCACAGCTTTCCCAACTCTTGG + Intergenic
1007554514 6:42754820-42754842 CTCACTGCAGCCCCAACTCCTGG - Intronic
1007946246 6:45829617-45829639 AGTATTGCTGTGCCAAATCCAGG - Intergenic
1008182965 6:48355991-48356013 AGCACTGAACTCCCAACTCCTGG - Intergenic
1009052848 6:58298848-58298870 AGCATTGCTGACCCATCTTCTGG - Intergenic
1009053361 6:58305552-58305574 AGCTATGCTGTCCTAATTCCAGG + Intergenic
1009237754 6:61145008-61145030 AGCTATGCTGTCCTAATTCCAGG - Intergenic
1011353018 6:86444309-86444331 AGCAGTCCTGTCCCACCTCCAGG + Intergenic
1011435802 6:87335346-87335368 AGCACTCCTGTAGCAACTTCAGG - Intronic
1013568914 6:111400361-111400383 AGCGCTGCTGTTCCACCTCTTGG + Intronic
1015938761 6:138428707-138428729 AGCACTGCTTTCCCAATTCTTGG - Intronic
1017043763 6:150328237-150328259 AACACTGATGTCCCAGCTCAAGG + Intergenic
1018033981 6:159866444-159866466 AACACTGCTGCCTCACCTCCAGG - Intergenic
1018430311 6:163716739-163716761 AGCACAGGTCTCCTAACTCCAGG + Intergenic
1018641219 6:165906458-165906480 AGCACTGTTTTTCAAACTCCAGG + Intronic
1018915984 6:168132652-168132674 GGAACTGCTGTCCCCACTCGGGG + Intergenic
1019190735 6:170249239-170249261 AGCACTGCTGCCCCACCCCCGGG - Intergenic
1019722659 7:2582606-2582628 TGCACTGCTGTTCCAGCTTCAGG - Exonic
1020155644 7:5721994-5722016 ATCACTGCAGCCTCAACTCCTGG + Intronic
1020426280 7:8069504-8069526 AGCACAGCTGCCCCACCCCCTGG - Intronic
1022908218 7:34876217-34876239 ATCACTGCTGTCCCACATCATGG + Intronic
1023524973 7:41092672-41092694 AGCTTTCCTGTCCCAACTGCGGG - Intergenic
1026498295 7:70921994-70922016 AGCACTGCGGTTCCAACACACGG - Intergenic
1027453608 7:78360714-78360736 AGCAGTGCTGTCCCTCCTGCTGG - Intronic
1030376330 7:108756598-108756620 AGCACTGAGCTTCCAACTCCTGG - Intergenic
1031838021 7:126702645-126702667 AAGACTGCTGTCCCAACTGCTGG - Intronic
1032617392 7:133489451-133489473 AGCACTTTTGTTGCAACTCCTGG + Intronic
1034309969 7:150078852-150078874 TCCTCTGCTGTCCCAGCTCCTGG - Intergenic
1034441717 7:151089017-151089039 AGCCCTGCTGTTCCCACTCCTGG + Intronic
1034548504 7:151805100-151805122 AGCACAGCTGCCCCAACTCAAGG - Intronic
1034744145 7:153507411-153507433 AGGACTGCAGTCCCACTTCCTGG - Intergenic
1034881707 7:154767760-154767782 AGCACTGCTCTCCATACTCCGGG + Intronic
1035076367 7:156180222-156180244 AGCAGTGCTGTCTCCACCCCAGG - Intergenic
1035092261 7:156323321-156323343 AGCAATGCAGTCCCATCTTCAGG + Intergenic
1035377358 7:158414246-158414268 AGTGCTGCTGTCCTCACTCCTGG - Intronic
1035492523 7:159292823-159292845 ATCACTGGTGCCCAAACTCCTGG - Intergenic
1036445700 8:8820260-8820282 AGCACAGCAGTCCCAACCCTGGG - Intronic
1038346316 8:26735542-26735564 AGCTCTGCTGCACAAACTCCAGG - Intergenic
1039504808 8:38044142-38044164 AGAACTGCTGTTCCCATTCCAGG - Intronic
1039697064 8:39924290-39924312 CTCACTGCAGCCCCAACTCCTGG - Intronic
1041548075 8:59069068-59069090 AGCACTGCTGTCCCAACTCCTGG - Intronic
1041645033 8:60243024-60243046 AGCTCTGCTGTCCTCACTTCTGG - Intronic
1044821241 8:96157573-96157595 AGCGCTGCTGGCCCAGCTCTAGG + Intronic
1045030828 8:98134418-98134440 AGGACTGCAGTCTCAACACCCGG + Intronic
1049285788 8:141774548-141774570 AGAAGTGATGTCCCATCTCCTGG + Intergenic
1049624265 8:143613066-143613088 AGCTTTGGTGTCCCACCTCCAGG + Intronic
1049646375 8:143737646-143737668 AGCACTGCAGACCCAAGGCCAGG - Intergenic
1049997223 9:1044895-1044917 AGCCCGCCTGTCCCAACCCCCGG - Intergenic
1050647060 9:7731646-7731668 AGCACAGCTGATCCAACTCAAGG + Intergenic
1050682227 9:8125267-8125289 AGCACTGCTGTCAAAACTGTGGG - Intergenic
1050699581 9:8323637-8323659 AGCAGTTCAGTCCCATCTCCTGG - Intronic
1050815929 9:9811340-9811362 GGCAATGCTGTCCCATCTTCAGG - Intronic
1052823685 9:33159703-33159725 AGCACAGCTCTCCCACCTCCAGG - Intronic
1053230394 9:36402803-36402825 AACAATGCTGTCACAACCCCAGG + Intronic
1053234789 9:36443230-36443252 AGTGTTGCTGTCCCCACTCCAGG - Intronic
1055322703 9:75097982-75098004 ACAACTGCAGTCCTAACTCCTGG - Intronic
1056617788 9:88183529-88183551 AGCACTGTTCTACCAACACCAGG + Intergenic
1057588069 9:96347323-96347345 AGCAGCGCTGTTCCCACTCCCGG + Intronic
1057731233 9:97610480-97610502 AGTCTTGCTGTCCCATCTCCAGG + Intronic
1058736021 9:107894797-107894819 ATCAGTGCTACCCCAACTCCTGG - Intergenic
1059079471 9:111233207-111233229 CTCACTGCAGTTCCAACTCCTGG - Intergenic
1059923688 9:119185783-119185805 AGTACAGCTGTGCAAACTCCAGG - Intronic
1060627193 9:125124518-125124540 AACACTGATGTCCCAGCTCAAGG + Intronic
1061480471 9:130895567-130895589 GGCACTGGTGTCCCCTCTCCGGG + Intergenic
1186055086 X:5641906-5641928 CTCACTGCAGCCCCAACTCCTGG + Intergenic
1187169366 X:16836332-16836354 ACCACTCTTGCCCCAACTCCAGG + Intronic
1187476807 X:19618457-19618479 TGCCATGCTGGCCCAACTCCAGG + Intronic
1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG + Intergenic
1189047880 X:37612359-37612381 AGCACTGGTGTTCAAACTTCAGG - Intronic
1190783082 X:53617387-53617409 ATCACTGCTCTCCTCACTCCAGG - Exonic
1192027231 X:67466529-67466551 AGGCCTGCTGTCACTACTCCTGG - Intergenic
1192087860 X:68119140-68119162 AGCAATTCTATCCAAACTCCTGG + Intronic
1192700719 X:73468646-73468668 ATTACTGCTCTCCCAACTACAGG - Intergenic
1192789917 X:74371360-74371382 ATAACTGCTGTCCCAACCCTAGG + Intergenic
1193593656 X:83419985-83420007 AGCACTCAGCTCCCAACTCCTGG - Intergenic
1194507577 X:94751908-94751930 ATCACCTCTTTCCCAACTCCAGG - Intergenic
1197734022 X:129836684-129836706 ATCACTGCTGTGGCCACTCCTGG - Intronic
1197970816 X:132113043-132113065 AGCAATCTTGTCCCCACTCCTGG + Intronic
1198663384 X:138995965-138995987 AGAACTGATGTTCCAACTGCTGG - Intronic
1198761682 X:140039092-140039114 ATCACTCCTCTCTCAACTCCAGG + Intergenic
1200135766 X:153873873-153873895 AGAGCTGCTGTCCCAGCCCCAGG + Intronic