ID: 1041552179

View in Genome Browser
Species Human (GRCh38)
Location 8:59115665-59115687
Sequence CTGGACAGACACATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041552179 Original CRISPR CTGGACAGACACATGGAGGC TGG (reversed) Intronic
900462673 1:2809022-2809044 CTGCACAGAGCCATGGAGCCAGG - Intergenic
900686967 1:3954789-3954811 CTGGACAGTCACATGGCAGAGGG - Intergenic
901207172 1:7503899-7503921 GGGGACAGAAGCATGGAGGCTGG + Intronic
901533817 1:9869959-9869981 CTGGGCAGACACACCCAGGCAGG + Intronic
901809283 1:11757734-11757756 ATGTACAGACGCATGGTGGCAGG + Intergenic
902733177 1:18383394-18383416 CTGGCCAAACACATGGCCGCTGG + Intergenic
903061731 1:20673315-20673337 CAGGACAGCCACAGAGAGGCTGG + Intronic
904136177 1:28314272-28314294 CTGGACAGAAAGGTGGAGCCTGG + Intergenic
904287362 1:29461127-29461149 CTGGCCAGTCACCAGGAGGCTGG + Intergenic
905474092 1:38213730-38213752 GCGGACAGACACATGGCGGGAGG + Intergenic
906674964 1:47686998-47687020 CAAGACAGACACATGGAGACAGG + Intergenic
906725067 1:48038434-48038456 CTGAACAAAGACCTGGAGGCAGG + Intergenic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
908646513 1:66284138-66284160 CTGGAAGGACACAGGAAGGCAGG + Intronic
909485626 1:76170267-76170289 GTGAACACCCACATGGAGGCAGG - Intronic
913053695 1:115138728-115138750 CTGGACAGACAAGTGGGGGATGG - Intergenic
917514236 1:175693791-175693813 CTGGACACATGCAAGGAGGCTGG - Intronic
921800648 1:219399111-219399133 GTGAACACCCACATGGAGGCAGG - Intergenic
921914857 1:220595957-220595979 CTTGACAGACATATGGAGCTGGG + Intronic
923687024 1:236160528-236160550 GTGGACAGACAGAAGGAGCCTGG - Intronic
1063735815 10:8753122-8753144 CTGGCCAGACACAAGAAGACAGG - Intergenic
1068504937 10:57888655-57888677 CTGGACAAATACATGAATGCAGG + Intergenic
1068878811 10:62027199-62027221 TTGGACAGATTCAAGGAGGCTGG - Intronic
1069895968 10:71680241-71680263 CTGGACAGCCAAAGGGAGGCAGG - Intronic
1070283016 10:75063570-75063592 CTGCACAGTCTCCTGGAGGCTGG + Intergenic
1070654843 10:78264292-78264314 CTGTGCAGGCACATGGAGGGAGG + Intergenic
1071369338 10:84935273-84935295 CTGGACATACATGAGGAGGCTGG + Intergenic
1072549886 10:96469465-96469487 AGGCACAGACACAGGGAGGCTGG - Intronic
1072569573 10:96646783-96646805 CTTCACAATCACATGGAGGCAGG - Intronic
1073043471 10:100622603-100622625 CTGGAAAGACTCAAGGAGGGAGG - Intergenic
1073148025 10:101293023-101293045 CTGGAGAGACACAGGGTGGGTGG - Intergenic
1073180286 10:101579254-101579276 CTGGGCAGACACTGGGAGCCGGG + Exonic
1073724169 10:106210521-106210543 CTGGCCAGTCCCATGGTGGCAGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075103028 10:119519289-119519311 GGGGACAGACACAGGGAGACAGG - Intronic
1075103121 10:119519688-119519710 GGGGACAGACACAGGGAGACAGG - Intronic
1075670834 10:124263112-124263134 CTGGAGAGACACAGGCAGGCAGG - Intergenic
1075725096 10:124606913-124606935 AGAGACAGACACATGGAGGGAGG - Intronic
1075873172 10:125785967-125785989 CAGGAAGGACACAAGGAGGCTGG + Intronic
1076329597 10:129654655-129654677 CTGGAGAGACAGGAGGAGGCAGG + Intronic
1076713347 10:132351064-132351086 CTCCACAGACACATTCAGGCAGG - Intronic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1080952110 11:37045990-37046012 TTGGAGAGAAACATGGAGGTTGG + Intergenic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1084006883 11:66327873-66327895 CTGGACACACACATGGGGACAGG - Intergenic
1084212092 11:67629052-67629074 CTAAACAGACACAAGGAGTCTGG + Intronic
1084283338 11:68114399-68114421 ATGAAAAGACACAGGGAGGCTGG + Intronic
1086407760 11:86513591-86513613 CTTGACAGACACCTAGAGGTGGG + Intronic
1088113256 11:106286264-106286286 CTAGACAGAAACATGAAGACTGG + Intergenic
1088837486 11:113590091-113590113 CTGTACCTACCCATGGAGGCTGG - Intergenic
1089253677 11:117182277-117182299 CTGTACAGAGACATGGAGTCTGG + Intronic
1090030078 11:123198522-123198544 CTGGACAAAGACATGGAGTTAGG + Intergenic
1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG + Intronic
1091394805 12:147533-147555 CTGGAATGACGCACGGAGGCTGG - Intronic
1092483180 12:8879062-8879084 CAGGACAGACACAAGGATGGAGG - Intronic
1096071218 12:48776440-48776462 CTGGCCAACCACATGGAGGCAGG - Exonic
1096849068 12:54423992-54424014 TTGGAGAGGCACATGGAGACAGG + Intergenic
1097872215 12:64610812-64610834 CCGCAGAGACACGTGGAGGCAGG - Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1101194085 12:102364949-102364971 CTGGTCAGTCACATGGTGGCTGG + Intergenic
1102012070 12:109624903-109624925 ATGGACAGACACATTGTGTCTGG - Intergenic
1102237245 12:111301438-111301460 GTGGACAGAGACAAGGACGCTGG + Intronic
1103135065 12:118499800-118499822 GTGGACACAGACAGGGAGGCAGG - Intergenic
1103587102 12:121963942-121963964 CTGGAAAGAAGGATGGAGGCAGG + Intronic
1103898551 12:124291078-124291100 GTGGACCGTGACATGGAGGCAGG - Intronic
1103905447 12:124325258-124325280 CTGGACGGACAGATGGATGGAGG + Exonic
1103906034 12:124327655-124327677 ACAGACAGACACATGGGGGCCGG + Intronic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1105447800 13:20472801-20472823 CTGGAACAACACATGGATGCTGG + Intronic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108602907 13:52010212-52010234 GTGGACAGACAGAGAGAGGCTGG - Intronic
1110709023 13:78629500-78629522 CTGAACAGAGACATGGAGAGAGG + Intronic
1113316225 13:109182285-109182307 CTGGACAAACACATGTAAGATGG + Intronic
1114382207 14:22218954-22218976 CTGGCCAGTCACCTGGAGCCTGG + Intergenic
1114658434 14:24329872-24329894 CTGGCTAACCACATGGAGGCAGG - Exonic
1114711315 14:24781241-24781263 CTGCAAAGTCCCATGGAGGCTGG - Intergenic
1119085684 14:71736943-71736965 CTGGACAGACACAACGAGGCTGG - Intronic
1119563461 14:75608981-75609003 CTGGAAAGACATAGGGAAGCTGG - Intronic
1121377706 14:93429983-93430005 ATGGAGAGACACTTGGAGTCGGG - Intronic
1121708269 14:96017520-96017542 CTGGGAAGCCACATGGAGTCAGG - Intergenic
1122083206 14:99281233-99281255 CTGGATCGAGACATGGAGGAAGG + Intergenic
1122324308 14:100873489-100873511 ATTGACAGACACATGGAGGGAGG - Intergenic
1124077836 15:26462420-26462442 GTGAACACCCACATGGAGGCAGG + Intergenic
1124594720 15:31083030-31083052 CTGGACGGAGACAAGGAGGAAGG + Intronic
1125070510 15:35547938-35547960 CTGTAGAGACACATGGAAGTGGG + Intergenic
1125166688 15:36714601-36714623 CTGCACTGACACACGGAGCCTGG - Intronic
1125432503 15:39609595-39609617 CTAGAGAAACACATGGATGCAGG - Intronic
1128635749 15:69301298-69301320 CTGGAAAAGCACATGGGGGCTGG - Intronic
1129272957 15:74428997-74429019 CTGGCCATACACCTGGTGGCTGG + Intronic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1132478163 16:152901-152923 TTGGTCAGAGACATGGCGGCAGG - Exonic
1132480112 16:163113-163135 TTGGTCAGAGACATGGCGGCAGG - Intronic
1133346753 16:5076213-5076235 CTGGACATGCACACGGAGGCTGG - Intronic
1133387941 16:5385887-5385909 CTGGAGAGACAAGTGGGGGCAGG + Intergenic
1135899757 16:26446179-26446201 GTGGACAGACTGAGGGAGGCTGG - Intergenic
1136556260 16:31009623-31009645 CTGGCCAGACTCTTGGAGCCGGG + Intronic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1137390282 16:48075527-48075549 CTGGACTGACAACTGGAGGATGG - Intergenic
1138525010 16:57600189-57600211 CTGGACAAACTCAAGAAGGCAGG + Intergenic
1139922743 16:70470223-70470245 CAGCAGAGACACATGGGGGCAGG - Intronic
1139951983 16:70676979-70677001 CTGGACAGGGACATGGATGGGGG + Intronic
1140068018 16:71626500-71626522 CGGGACACACACAGGGACGCGGG + Exonic
1141089102 16:81117674-81117696 GTGCACAGACCCATTGAGGCGGG + Intergenic
1141461382 16:84180407-84180429 CTGGAGAGCCACATGGGGCCTGG - Intronic
1141569815 16:84927844-84927866 CTGGACAAACACTTGGAGTAGGG - Intergenic
1142033450 16:87849830-87849852 CTGGTCAGACACATGCATGGGGG + Intronic
1142270703 16:89088049-89088071 CGGGACAGACACCAGGAGGCAGG + Intergenic
1142680709 17:1546608-1546630 CTGTACCCACACATGGAGGCTGG + Intronic
1142855898 17:2730122-2730144 TTGGACAGAGACATGGATACAGG + Intergenic
1143410707 17:6706767-6706789 CTGGACACACACCTGGAGCGTGG + Exonic
1146420203 17:32677937-32677959 CTGGAAGGACACCTGGAGGGCGG - Intronic
1147218793 17:38916067-38916089 CAGGACAGACCCATTGAGGAGGG - Intronic
1147596692 17:41722615-41722637 CTAGAGAGACAGCTGGAGGCTGG + Intronic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1148606696 17:48934952-48934974 CTGGACTCGCACATAGAGGCTGG + Intronic
1148774951 17:50090033-50090055 CTGGACAGACAGATGTTGGGAGG + Intronic
1149569920 17:57665137-57665159 CTGGGAAGACTAATGGAGGCTGG - Intronic
1149869207 17:60167771-60167793 CTGGGAAGACACATGGAGCTAGG - Intronic
1151800356 17:76375870-76375892 CTGGAAAAAGACATGGAGCCCGG - Intronic
1152103480 17:78315990-78316012 CTGGACAGACAGACAGATGCAGG - Intergenic
1152914551 17:83026750-83026772 CTCGACAGACACACAGAGGAGGG + Intronic
1152914581 17:83026894-83026916 CTCGACAGACACACAGAGGAGGG + Intronic
1152914637 17:83027134-83027156 CTGGACAGACACACGGAGGGGGG + Intronic
1154251167 18:12746416-12746438 CTGGACAGACACAGGGTGAGGGG + Intergenic
1154338342 18:13483422-13483444 CTGGACAGACCCCTGGACCCGGG + Intronic
1155097154 18:22567929-22567951 CTTGACAAATACATGGAGTCAGG + Intergenic
1156368134 18:36448475-36448497 CTGGCCAGCTGCATGGAGGCAGG - Intronic
1157014375 18:43693060-43693082 CTGAAAAGACACATAGAGACTGG + Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1158264544 18:55647387-55647409 ATGCACAGACACATGGAAGAGGG - Intronic
1160175465 18:76590527-76590549 CTGGACAGGGACATGGCTGCTGG - Intergenic
1160895402 19:1399939-1399961 CTGGGCAGACACAGGGCGCCTGG + Intronic
1161075296 19:2282333-2282355 CTGGACAGAGACCAGGAGGTGGG + Intronic
1163158701 19:15452518-15452540 CTGGACAGACTTATTGGGGCGGG + Intronic
1163415633 19:17184841-17184863 TAGGACAGACACATGGGGTCCGG - Intronic
1164625641 19:29725906-29725928 CTGCACAGAGGCATGAAGGCTGG + Intergenic
1165212828 19:34249334-34249356 CTGGCCAGACACACGTGGGCAGG + Intergenic
1165903109 19:39177946-39177968 CTGCACAGACACATGAGGCCCGG - Intronic
1166709934 19:44930354-44930376 CTGGGCATACGCAGGGAGGCTGG + Intergenic
1166887136 19:45968712-45968734 CTTGTCTGAAACATGGAGGCAGG - Intronic
1167111901 19:47467498-47467520 CAGGTCAGACACAGGGAAGCTGG - Intronic
1168096310 19:54117159-54117181 CTGTACAAAGACCTGGAGGCGGG + Intronic
925779822 2:7371979-7372001 CTGGGAAGACAAATGGAGACTGG + Intergenic
926043532 2:9693250-9693272 CTGGACAGGCATCAGGAGGCTGG + Intergenic
926128400 2:10285772-10285794 CTGGGCGGACCCAGGGAGGCTGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927678033 2:25121346-25121368 CTGCACAAACACACGGGGGCGGG - Intronic
927884926 2:26712573-26712595 GTGGACAGACACAGGGAAGGGGG - Intronic
928111651 2:28515322-28515344 CTGCACAGACAGATGGTAGCTGG - Intronic
929864191 2:45704348-45704370 CTGGACAGGGACATAGAGGGAGG - Intronic
930000590 2:46859136-46859158 CTGGACAGATAAACAGAGGCAGG + Intergenic
931344623 2:61434337-61434359 CCTGACAGACACATCTAGGCTGG + Intronic
932746551 2:74338248-74338270 CTGGGGAGACACATGGATGGGGG + Intronic
934606273 2:95697858-95697880 CTGGACATACACTGGGATGCTGG + Intergenic
935816831 2:106853612-106853634 CTGGACAGACTCATGTGAGCTGG + Intronic
936288298 2:111198697-111198719 CTTCACAGAAACATGGAGACTGG + Intergenic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
937895888 2:126976637-126976659 CTACACAGACACAGGGACGCTGG - Intergenic
938498032 2:131813538-131813560 CTGCACAGACCCGGGGAGGCCGG - Intergenic
943771254 2:191720297-191720319 CTGGACAGACAGAACGAGGCAGG + Intergenic
944432367 2:199647050-199647072 CTGGACAGCCTCGTGGAGACTGG - Intergenic
944607368 2:201363980-201364002 CTGCTCAGACACAGGGAGGGAGG - Intergenic
945321085 2:208424469-208424491 CAGGGCAGACCCATGAAGGCAGG - Intronic
946386506 2:219387410-219387432 CTGGGCAGGGACATGGGGGCGGG - Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948385784 2:237579745-237579767 CTGGACAGAGAACAGGAGGCTGG + Intronic
948890170 2:240903555-240903577 CTGTACAGACACAGGGGGGCAGG + Intergenic
948992054 2:241560287-241560309 CTGGACAGTCACAGTGGGGCTGG - Intronic
1172099987 20:32479617-32479639 CTGGCCAGTCACATGGGGACTGG - Intronic
1172293434 20:33791747-33791769 CTGGGCAGAGCCATGGTGGCAGG + Exonic
1172514410 20:35523102-35523124 CTCGCCAGGCACGTGGAGGCAGG + Intergenic
1172988641 20:39014747-39014769 AAGAACAGAAACATGGAGGCTGG + Intronic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1173951653 20:46998182-46998204 CTGGACAGACACACTGAGGGTGG - Intronic
1175501167 20:59452254-59452276 CTGGAGAGAGACAGGAAGGCTGG - Intergenic
1175817253 20:61889719-61889741 ATGGACAGACAGATGGATGATGG + Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1178241954 21:30912960-30912982 CTTAACAGCCACAGGGAGGCTGG + Intergenic
1179238241 21:39566224-39566246 CTGGAGAGAGGCATGGTGGCTGG + Intronic
1179486273 21:41712593-41712615 CTGGAGAGACAAAGGGAGGTGGG - Intergenic
1180238274 21:46479156-46479178 TTGGACAGACTCAGAGAGGCAGG - Intronic
1180559243 22:16602033-16602055 CAGGAAAGACACATGGATCCCGG - Intergenic
1180947456 22:19704523-19704545 GTTGACAGAAACATGGAGCCAGG + Intergenic
1181002406 22:19994082-19994104 ATGGACAGACAGATGGATACAGG + Intronic
1182468392 22:30532175-30532197 ATGGACAGACACAAAGAGGTCGG - Intronic
1183469358 22:37997407-37997429 CTGGAGAGAGACAGGGAGCCAGG - Intronic
1183680926 22:39328723-39328745 ATGCACAGGCTCATGGAGGCTGG - Intergenic
1185144441 22:49123351-49123373 ATGGGCAGCCAGATGGAGGCTGG - Intergenic
950723738 3:14902389-14902411 CTGGGCAAAGACATGGAGGTTGG + Intronic
952530812 3:34260017-34260039 CTGGCCAGGGACATAGAGGCTGG + Intergenic
952536081 3:34310406-34310428 GTGTACAGACACATGGAGCCAGG - Intergenic
953464164 3:43105215-43105237 CTAAACACACACATGGAGTCAGG + Intronic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954107300 3:48416199-48416221 CAGACCAGACACATGGAGGCAGG + Intronic
954389833 3:50262892-50262914 GAGGACAGGCACAGGGAGGCGGG - Intergenic
954692076 3:52400967-52400989 CTGGCCTGAGATATGGAGGCTGG - Intergenic
955195632 3:56802294-56802316 CTGTAGTGACACCTGGAGGCAGG + Intronic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
959585315 3:108020246-108020268 CTGAACAAACACATGGGGGCAGG + Intergenic
960864466 3:122185057-122185079 CAGGAAATACACATGGAGGCTGG - Intronic
960993878 3:123328656-123328678 CTAGCCAACCACATGGAGGCTGG - Exonic
962326125 3:134433740-134433762 CTGGACAGAGATACGGAGGCAGG - Intergenic
962464840 3:135648726-135648748 GTGAACACCCACATGGAGGCAGG - Intergenic
962549466 3:136474982-136475004 CTGTACAGAAGCAAGGAGGCTGG - Intronic
964319401 3:155479369-155479391 CTGGACAGGCACTGGGAGTCTGG - Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
967374337 3:188783737-188783759 CTTGATAGAAAAATGGAGGCAGG - Intronic
967997950 3:195180690-195180712 CTGGACACACACAAGCAGACGGG + Intronic
968893785 4:3386710-3386732 CTTGTCAGACACAGGCAGGCGGG - Intronic
969477042 4:7427705-7427727 CAGGAGTGTCACATGGAGGCAGG + Intronic
969694916 4:8729108-8729130 CTAGACAGACAGATGGACACTGG + Intergenic
969890886 4:10258995-10259017 GTGGGCAGACAGGTGGAGGCTGG + Intergenic
970599206 4:17627597-17627619 CTGGGCAGGAACATGGCGGCAGG - Exonic
971240899 4:24887910-24887932 CTGAACAGGAACATGGAGGGCGG - Intronic
971307505 4:25496472-25496494 CTGGAGAGATAAATGGTGGCAGG - Intergenic
973304558 4:48630863-48630885 CTTGTCAGATACAAGGAGGCTGG - Intronic
975245559 4:72116949-72116971 CTGGTCAGACAGATACAGGCAGG - Intronic
975611503 4:76208512-76208534 CTGGAAAGTCACACTGAGGCGGG + Intronic
975730135 4:77329824-77329846 CTGTACAGAGACAGGGAGGGGGG + Intronic
977281913 4:95050279-95050301 CTCGTCAGAAACATGGAGGTTGG - Intronic
978388902 4:108203792-108203814 CTGGAAAGGCACATTGAAGCAGG + Intergenic
981042230 4:140233780-140233802 CTGGACAGAAGCAAGGATGCTGG + Intergenic
984230831 4:177096810-177096832 ATGTACAGACATATGAAGGCAGG - Intergenic
985952970 5:3237405-3237427 CTGCACAGACACATGGAATGGGG - Intergenic
986651785 5:9971370-9971392 GTGGACAGAAACATCTAGGCAGG - Intergenic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990396820 5:55390598-55390620 ATGGTCAGACACATGGGAGCTGG - Intronic
992023380 5:72647466-72647488 ATGGACAGACCCAAAGAGGCTGG + Intergenic
993130862 5:83896515-83896537 ATGGACAGTCACATGGAGGGAGG + Intergenic
995750869 5:115452060-115452082 CTGTACAGACACAGAGAGGTGGG - Intergenic
997273548 5:132563225-132563247 CTGGACAGAAACATTGATGCAGG + Intronic
997657278 5:135564635-135564657 ATGGGCAGACACATGGAGAGAGG + Intergenic
998127584 5:139634857-139634879 CTGCACACACACATACAGGCTGG - Intergenic
998866423 5:146508240-146508262 CTAGACAGACATATTTAGGCTGG + Intronic
1001153159 5:169249784-169249806 CTTGACAGATACATGGCTGCTGG + Intronic
1001644365 5:173269242-173269264 CTGGACACAGACTTGGGGGCGGG + Intergenic
1001982055 5:176044481-176044503 CTGGACATCCACTTGGAGCCTGG + Intergenic
1002235407 5:177799576-177799598 CTGGACATCCACTTGGAGCCTGG - Intergenic
1002341595 5:178519819-178519841 ATGGACAGATAGATGGAGGATGG + Intronic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1004862356 6:19817783-19817805 CTGGACAGACTCATAGAGCTGGG - Intergenic
1005097165 6:22129694-22129716 CTGGGCAGACACATGGTAGTGGG + Intergenic
1005821806 6:29604945-29604967 CTGGACAGAATCATGGTGACAGG + Exonic
1006990754 6:38212817-38212839 TTGGACAGCCACACGGAGCCAGG - Intronic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1011013175 6:82724829-82724851 CTGGACAACCTCAAGGAGGCGGG + Intergenic
1012677281 6:102132553-102132575 CAGGACAGAGACATGGAGAAAGG + Intergenic
1013469021 6:110444617-110444639 TTGGACAGTCACAAAGAGGCCGG + Intronic
1015757124 6:136619051-136619073 CTGGACTGACATATGGAGCCTGG + Intronic
1017048141 6:150366199-150366221 CTGCACATGCTCATGGAGGCAGG - Intergenic
1017925156 6:158904915-158904937 CTGGAAGGAAACATGGGGGCAGG - Intronic
1018366909 6:163130286-163130308 CCGGACAGACACAGGGAAGCTGG - Intronic
1018728286 6:166630111-166630133 CTGGACAGACAAGAGGAGGCGGG + Intronic
1018733188 6:166668675-166668697 CTGAAGAGGCACAGGGAGGCTGG + Intronic
1022809199 7:33852214-33852236 CTGGCCAGACACATGATGCCTGG + Intergenic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1027197005 7:76037553-76037575 TTGAGCAGACACAGGGAGGCAGG - Intronic
1031207585 7:118780537-118780559 GTGGACAGAGACCTGGATGCTGG - Intergenic
1032080305 7:128855304-128855326 CTGGGCACAAACCTGGAGGCTGG - Exonic
1032238077 7:130141505-130141527 CAGGAGGGACGCATGGAGGCCGG + Intergenic
1033175320 7:139118480-139118502 ATGGTCAGACAAATGGAGGAAGG + Intergenic
1034618003 7:152435796-152435818 CAGGAAAGACACATGGATCCCGG + Exonic
1035272398 7:157728128-157728150 CTGGGCAGACACATGCAGCCCGG + Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1036480243 8:9133064-9133086 GTGGACAGAGACATTGAGGTCGG - Intergenic
1036619590 8:10415762-10415784 GTGACCAAACACATGGAGGCTGG - Intronic
1037325063 8:17680820-17680842 CTGAGCAGACACATGAAGGAAGG + Intronic
1037424980 8:18745972-18745994 CTAGACAGACAGACAGAGGCAGG + Intronic
1037710883 8:21354677-21354699 CTGGAGAGACACTTGGCTGCAGG + Intergenic
1038685952 8:29718710-29718732 CTGGACTCCCACAAGGAGGCCGG + Intergenic
1039475667 8:37838142-37838164 CTGGATATAGGCATGGAGGCCGG - Intronic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1041644643 8:60238913-60238935 TTTGACAGAAAGATGGAGGCTGG + Intronic
1042207481 8:66343829-66343851 CTGGACAGACACCTCGAGGGAGG - Intergenic
1045313241 8:101021886-101021908 CTCCACAGCCACATGGATGCTGG + Intergenic
1045895211 8:107208263-107208285 CTAGACAGACACAAGCAGGGCGG + Intergenic
1046625910 8:116576834-116576856 ATGGACTGAGACAAGGAGGCCGG + Intergenic
1047432394 8:124804339-124804361 CTTTACAGAAACATTGAGGCAGG + Intergenic
1048034670 8:130666161-130666183 CAGGACAGACACCTGGAGGCGGG - Intergenic
1048337975 8:133517155-133517177 CTGGACAGTCCCATGGATGAGGG + Intronic
1051480693 9:17556820-17556842 CTGGACACCCTCGTGGAGGCTGG - Intergenic
1051638457 9:19202755-19202777 TTGGACAGACAGATGCAGGGGGG - Intergenic
1051672669 9:19527821-19527843 CTGGACAGCCATGTGGAGGCAGG - Intronic
1052117953 9:24671777-24671799 CTGCACTGAAACATGGGGGCAGG + Intergenic
1052520472 9:29541536-29541558 AAGGACAGAGAGATGGAGGCAGG - Intergenic
1052821056 9:33138137-33138159 CGGGACAGACACCTGCAGGCTGG + Intronic
1053667449 9:40326086-40326108 AAGGACATATACATGGAGGCTGG + Intronic
1053917029 9:42951189-42951211 AAGGACATATACATGGAGGCTGG + Intergenic
1054378594 9:64466113-64466135 AAGGACATATACATGGAGGCTGG + Intergenic
1054517162 9:66050199-66050221 AAGGACATATACATGGAGGCTGG - Intergenic
1056161679 9:83902284-83902306 ATGGACAGAACCATGGAAGCTGG + Intronic
1056358448 9:85826922-85826944 ATGGACAGAACCATGGAAGCTGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061486334 9:130922329-130922351 CTGGAGAGAGACTGGGAGGCCGG - Intronic
1062016981 9:134295934-134295956 CTGGTCAGTCACATTGAGTCTGG - Intergenic
1062179523 9:135183737-135183759 CTGCACAGACACTCGGAGGTAGG + Intergenic
1062744403 9:138202242-138202264 CAGGACAGACACAGGCAGACAGG + Intergenic
1186216282 X:7304725-7304747 ATGGAGAGCCACTTGGAGGCAGG - Intronic
1188590117 X:31823270-31823292 CTGGAAAGACACATGCTGACAGG - Intronic
1189305285 X:39982286-39982308 CCTGACCGATACATGGAGGCTGG + Intergenic
1189480563 X:41389470-41389492 GTAGGCAGAAACATGGAGGCAGG + Intergenic
1191087958 X:56588820-56588842 CTGGACAGTGACATGCAGCCAGG - Intergenic
1193442413 X:81558921-81558943 CTGTAAAGACACATGCAGACTGG + Intergenic
1193608170 X:83594040-83594062 ATGGACAGACGCAGGCAGGCTGG + Intergenic
1193980502 X:88176214-88176236 CTGGGCAGGCACCTGGAAGCAGG - Intergenic
1195308009 X:103604595-103604617 CTGGACAGAAAACTGGAGTCAGG - Intergenic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1196164411 X:112522705-112522727 CTGAACAACCACATGCAGGCAGG + Intergenic
1198048996 X:132930509-132930531 CTGACCAGAGACATTGAGGCAGG + Intronic