ID: 1041554401

View in Genome Browser
Species Human (GRCh38)
Location 8:59136282-59136304
Sequence GCATTTTGACTTTTGGATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041554398_1041554401 -3 Left 1041554398 8:59136262-59136284 CCACTGGCCTCAGAGAATAAGCA No data
Right 1041554401 8:59136282-59136304 GCATTTTGACTTTTGGATCACGG No data
1041554399_1041554401 -10 Left 1041554399 8:59136269-59136291 CCTCAGAGAATAAGCATTTTGAC No data
Right 1041554401 8:59136282-59136304 GCATTTTGACTTTTGGATCACGG No data
1041554397_1041554401 3 Left 1041554397 8:59136256-59136278 CCATCACCACTGGCCTCAGAGAA No data
Right 1041554401 8:59136282-59136304 GCATTTTGACTTTTGGATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041554401 Original CRISPR GCATTTTGACTTTTGGATCA CGG Intergenic
No off target data available for this crispr