ID: 1041558614

View in Genome Browser
Species Human (GRCh38)
Location 8:59188046-59188068
Sequence CCCCGAAGCCTGCTGTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041558608_1041558614 15 Left 1041558608 8:59188008-59188030 CCAGCTTTTCTTCAAGCGGGCTG No data
Right 1041558614 8:59188046-59188068 CCCCGAAGCCTGCTGTGGACTGG No data
1041558607_1041558614 16 Left 1041558607 8:59188007-59188029 CCCAGCTTTTCTTCAAGCGGGCT No data
Right 1041558614 8:59188046-59188068 CCCCGAAGCCTGCTGTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041558614 Original CRISPR CCCCGAAGCCTGCTGTGGAC TGG Intergenic
No off target data available for this crispr