ID: 1041567018

View in Genome Browser
Species Human (GRCh38)
Location 8:59290183-59290205
Sequence CTTCAAAACTCTATGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041567014_1041567018 12 Left 1041567014 8:59290148-59290170 CCTTCATGTATTTTACTTTTGCT No data
Right 1041567018 8:59290183-59290205 CTTCAAAACTCTATGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041567018 Original CRISPR CTTCAAAACTCTATGGGGCA AGG Intergenic
No off target data available for this crispr