ID: 1041572043

View in Genome Browser
Species Human (GRCh38)
Location 8:59348747-59348769
Sequence TGTCCTTTGCAGAACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041572041_1041572043 -3 Left 1041572041 8:59348727-59348749 CCATAAAAAGGACAAGATCATGT No data
Right 1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041572043 Original CRISPR TGTCCTTTGCAGAACATGGA TGG Intergenic
No off target data available for this crispr