ID: 1041572512

View in Genome Browser
Species Human (GRCh38)
Location 8:59353248-59353270
Sequence GTGGAAAAGTGGAATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041572506_1041572512 16 Left 1041572506 8:59353209-59353231 CCCGAAGCCATGGTTTTTAGTTT 0: 52
1: 57
2: 38
3: 63
4: 353
Right 1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG No data
1041572508_1041572512 9 Left 1041572508 8:59353216-59353238 CCATGGTTTTTAGTTTCTGTCTT 0: 3
1: 71
2: 73
3: 119
4: 993
Right 1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG No data
1041572507_1041572512 15 Left 1041572507 8:59353210-59353232 CCGAAGCCATGGTTTTTAGTTTC 0: 6
1: 4
2: 7
3: 22
4: 272
Right 1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041572512 Original CRISPR GTGGAAAAGTGGAATGAGAA GGG Intergenic
No off target data available for this crispr