ID: 1041582233

View in Genome Browser
Species Human (GRCh38)
Location 8:59474350-59474372
Sequence TAATTAGGAAATACAATGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041582233_1041582240 4 Left 1041582233 8:59474350-59474372 CCGGCCATTGTATTTCCTAATTA No data
Right 1041582240 8:59474377-59474399 GGGAGGATGGCTTCTTATCAAGG No data
1041582233_1041582238 -9 Left 1041582233 8:59474350-59474372 CCGGCCATTGTATTTCCTAATTA No data
Right 1041582238 8:59474364-59474386 TCCTAATTATGCTGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041582233 Original CRISPR TAATTAGGAAATACAATGGC CGG (reversed) Intergenic
No off target data available for this crispr