ID: 1041582238

View in Genome Browser
Species Human (GRCh38)
Location 8:59474364-59474386
Sequence TCCTAATTATGCTGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041582233_1041582238 -9 Left 1041582233 8:59474350-59474372 CCGGCCATTGTATTTCCTAATTA No data
Right 1041582238 8:59474364-59474386 TCCTAATTATGCTGGGAGGATGG No data
1041582232_1041582238 3 Left 1041582232 8:59474338-59474360 CCAGCTCTGGTTCCGGCCATTGT No data
Right 1041582238 8:59474364-59474386 TCCTAATTATGCTGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041582238 Original CRISPR TCCTAATTATGCTGGGAGGA TGG Intergenic
No off target data available for this crispr