ID: 1041582240

View in Genome Browser
Species Human (GRCh38)
Location 8:59474377-59474399
Sequence GGGAGGATGGCTTCTTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041582233_1041582240 4 Left 1041582233 8:59474350-59474372 CCGGCCATTGTATTTCCTAATTA No data
Right 1041582240 8:59474377-59474399 GGGAGGATGGCTTCTTATCAAGG No data
1041582232_1041582240 16 Left 1041582232 8:59474338-59474360 CCAGCTCTGGTTCCGGCCATTGT No data
Right 1041582240 8:59474377-59474399 GGGAGGATGGCTTCTTATCAAGG No data
1041582234_1041582240 0 Left 1041582234 8:59474354-59474376 CCATTGTATTTCCTAATTATGCT No data
Right 1041582240 8:59474377-59474399 GGGAGGATGGCTTCTTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041582240 Original CRISPR GGGAGGATGGCTTCTTATCA AGG Intergenic
No off target data available for this crispr