ID: 1041586736

View in Genome Browser
Species Human (GRCh38)
Location 8:59529330-59529352
Sequence CTCCATTTACTGACAGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041586736_1041586738 -6 Left 1041586736 8:59529330-59529352 CCTTGTGCTGTCAGTAAATGGAG No data
Right 1041586738 8:59529347-59529369 ATGGAGTGTTTGATGATATTGGG No data
1041586736_1041586741 17 Left 1041586736 8:59529330-59529352 CCTTGTGCTGTCAGTAAATGGAG No data
Right 1041586741 8:59529370-59529392 GAAGATTGAATTACAAGACAGGG No data
1041586736_1041586737 -7 Left 1041586736 8:59529330-59529352 CCTTGTGCTGTCAGTAAATGGAG No data
Right 1041586737 8:59529346-59529368 AATGGAGTGTTTGATGATATTGG No data
1041586736_1041586740 16 Left 1041586736 8:59529330-59529352 CCTTGTGCTGTCAGTAAATGGAG No data
Right 1041586740 8:59529369-59529391 GGAAGATTGAATTACAAGACAGG No data
1041586736_1041586739 -5 Left 1041586736 8:59529330-59529352 CCTTGTGCTGTCAGTAAATGGAG No data
Right 1041586739 8:59529348-59529370 TGGAGTGTTTGATGATATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041586736 Original CRISPR CTCCATTTACTGACAGCACA AGG (reversed) Intergenic
No off target data available for this crispr