ID: 1041601075

View in Genome Browser
Species Human (GRCh38)
Location 8:59717902-59717924
Sequence TTGGCAAGGAATAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041601075_1041601081 8 Left 1041601075 8:59717902-59717924 CCATCTTCCCTATTCCTTGCCAA No data
Right 1041601081 8:59717933-59717955 ACAGTAAAGAGCAGACAACATGG No data
1041601075_1041601082 14 Left 1041601075 8:59717902-59717924 CCATCTTCCCTATTCCTTGCCAA No data
Right 1041601082 8:59717939-59717961 AAGAGCAGACAACATGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041601075 Original CRISPR TTGGCAAGGAATAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr