ID: 1041605674

View in Genome Browser
Species Human (GRCh38)
Location 8:59780021-59780043
Sequence GTGGCATCTCAGAAATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041605670_1041605674 0 Left 1041605670 8:59779998-59780020 CCTTGTCAGGAAGTCTGTGGCTG No data
Right 1041605674 8:59780021-59780043 GTGGCATCTCAGAAATTTGTGGG No data
1041605668_1041605674 6 Left 1041605668 8:59779992-59780014 CCTACTCCTTGTCAGGAAGTCTG No data
Right 1041605674 8:59780021-59780043 GTGGCATCTCAGAAATTTGTGGG No data
1041605665_1041605674 16 Left 1041605665 8:59779982-59780004 CCCAGGAAGGCCTACTCCTTGTC No data
Right 1041605674 8:59780021-59780043 GTGGCATCTCAGAAATTTGTGGG No data
1041605666_1041605674 15 Left 1041605666 8:59779983-59780005 CCAGGAAGGCCTACTCCTTGTCA No data
Right 1041605674 8:59780021-59780043 GTGGCATCTCAGAAATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041605674 Original CRISPR GTGGCATCTCAGAAATTTGT GGG Intergenic
No off target data available for this crispr