ID: 1041606502

View in Genome Browser
Species Human (GRCh38)
Location 8:59788190-59788212
Sequence GAGAATTGGGAGATGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041606502_1041606510 3 Left 1041606502 8:59788190-59788212 CCTGCCTCCATCTCCCAATTCTC No data
Right 1041606510 8:59788216-59788238 CCTCAAGCTCCCAAGAAGCTGGG No data
1041606502_1041606508 2 Left 1041606502 8:59788190-59788212 CCTGCCTCCATCTCCCAATTCTC No data
Right 1041606508 8:59788215-59788237 GCCTCAAGCTCCCAAGAAGCTGG No data
1041606502_1041606513 30 Left 1041606502 8:59788190-59788212 CCTGCCTCCATCTCCCAATTCTC No data
Right 1041606513 8:59788243-59788265 CAGATGCCCACTACCCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041606502 Original CRISPR GAGAATTGGGAGATGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr