ID: 1041607954

View in Genome Browser
Species Human (GRCh38)
Location 8:59806784-59806806
Sequence TTGAATAAGGGTGATAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041607954_1041607958 15 Left 1041607954 8:59806784-59806806 CCATCCTTATCACCCTTATTCAA No data
Right 1041607958 8:59806822-59806844 TCTAGCCATTGCATGCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041607954 Original CRISPR TTGAATAAGGGTGATAAGGA TGG (reversed) Intergenic
No off target data available for this crispr