ID: 1041609549

View in Genome Browser
Species Human (GRCh38)
Location 8:59828771-59828793
Sequence GACCTGCTCCCTGTTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041609549_1041609551 5 Left 1041609549 8:59828771-59828793 CCAGTTTTAACAGGGAGCAGGTC No data
Right 1041609551 8:59828799-59828821 AACTCTTCATATTGACACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041609549 Original CRISPR GACCTGCTCCCTGTTAAAAC TGG (reversed) Intergenic
No off target data available for this crispr