ID: 1041620913

View in Genome Browser
Species Human (GRCh38)
Location 8:59968105-59968127
Sequence GCATTAAAAATGATGGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041620913_1041620916 1 Left 1041620913 8:59968105-59968127 CCAACATCCATCATTTTTAATGC No data
Right 1041620916 8:59968129-59968151 AGTGATACTCATACCCATCAGGG No data
1041620913_1041620915 0 Left 1041620913 8:59968105-59968127 CCAACATCCATCATTTTTAATGC No data
Right 1041620915 8:59968128-59968150 AAGTGATACTCATACCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041620913 Original CRISPR GCATTAAAAATGATGGATGT TGG (reversed) Intergenic
No off target data available for this crispr