ID: 1041623729

View in Genome Browser
Species Human (GRCh38)
Location 8:60001252-60001274
Sequence ACATACCTGCAGATGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041623729_1041623739 26 Left 1041623729 8:60001252-60001274 CCAGCCACCATCTGCAGGTATGT No data
Right 1041623739 8:60001301-60001323 TTTGGAATGGAGCTCCCAGAGGG No data
1041623729_1041623733 -7 Left 1041623729 8:60001252-60001274 CCAGCCACCATCTGCAGGTATGT No data
Right 1041623733 8:60001268-60001290 GGTATGTTCAGGCCAGCAACAGG No data
1041623729_1041623741 30 Left 1041623729 8:60001252-60001274 CCAGCCACCATCTGCAGGTATGT No data
Right 1041623741 8:60001305-60001327 GAATGGAGCTCCCAGAGGGAGGG No data
1041623729_1041623738 25 Left 1041623729 8:60001252-60001274 CCAGCCACCATCTGCAGGTATGT No data
Right 1041623738 8:60001300-60001322 CTTTGGAATGGAGCTCCCAGAGG No data
1041623729_1041623740 29 Left 1041623729 8:60001252-60001274 CCAGCCACCATCTGCAGGTATGT No data
Right 1041623740 8:60001304-60001326 GGAATGGAGCTCCCAGAGGGAGG No data
1041623729_1041623736 13 Left 1041623729 8:60001252-60001274 CCAGCCACCATCTGCAGGTATGT No data
Right 1041623736 8:60001288-60001310 AGGACTGTACCACTTTGGAATGG No data
1041623729_1041623735 8 Left 1041623729 8:60001252-60001274 CCAGCCACCATCTGCAGGTATGT No data
Right 1041623735 8:60001283-60001305 GCAACAGGACTGTACCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041623729 Original CRISPR ACATACCTGCAGATGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr