ID: 1041627774

View in Genome Browser
Species Human (GRCh38)
Location 8:60050274-60050296
Sequence GGGAGTAAATGCAGGTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041627774_1041627782 12 Left 1041627774 8:60050274-60050296 CCATGGGACCTGCATTTACTCCC No data
Right 1041627782 8:60050309-60050331 CTGCCTATTAGCATGGGCAATGG No data
1041627774_1041627780 5 Left 1041627774 8:60050274-60050296 CCATGGGACCTGCATTTACTCCC No data
Right 1041627780 8:60050302-60050324 AAATGAGCTGCCTATTAGCATGG No data
1041627774_1041627783 13 Left 1041627774 8:60050274-60050296 CCATGGGACCTGCATTTACTCCC No data
Right 1041627783 8:60050310-60050332 TGCCTATTAGCATGGGCAATGGG No data
1041627774_1041627784 14 Left 1041627774 8:60050274-60050296 CCATGGGACCTGCATTTACTCCC No data
Right 1041627784 8:60050311-60050333 GCCTATTAGCATGGGCAATGGGG No data
1041627774_1041627781 6 Left 1041627774 8:60050274-60050296 CCATGGGACCTGCATTTACTCCC No data
Right 1041627781 8:60050303-60050325 AATGAGCTGCCTATTAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041627774 Original CRISPR GGGAGTAAATGCAGGTCCCA TGG (reversed) Intergenic
No off target data available for this crispr