ID: 1041630700

View in Genome Browser
Species Human (GRCh38)
Location 8:60083520-60083542
Sequence GATGATTGGGATCCAAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041630700_1041630705 -9 Left 1041630700 8:60083520-60083542 CCCACTCTTGGATCCCAATCATC No data
Right 1041630705 8:60083534-60083556 CCAATCATCTGTGGCCAGATTGG No data
1041630700_1041630707 8 Left 1041630700 8:60083520-60083542 CCCACTCTTGGATCCCAATCATC No data
Right 1041630707 8:60083551-60083573 GATTGGAGTCAACAATGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041630700 Original CRISPR GATGATTGGGATCCAAGAGT GGG (reversed) Intergenic
No off target data available for this crispr