ID: 1041632733

View in Genome Browser
Species Human (GRCh38)
Location 8:60106209-60106231
Sequence GCTATTCCTCCAATCAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041632733_1041632737 -5 Left 1041632733 8:60106209-60106231 CCACCTTTGATTGGAGGAATAGC No data
Right 1041632737 8:60106227-60106249 ATAGCAGGAGAGCATAGTGAGGG No data
1041632733_1041632738 8 Left 1041632733 8:60106209-60106231 CCACCTTTGATTGGAGGAATAGC No data
Right 1041632738 8:60106240-60106262 ATAGTGAGGGAAGAAGTTGATGG No data
1041632733_1041632736 -6 Left 1041632733 8:60106209-60106231 CCACCTTTGATTGGAGGAATAGC No data
Right 1041632736 8:60106226-60106248 AATAGCAGGAGAGCATAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041632733 Original CRISPR GCTATTCCTCCAATCAAAGG TGG (reversed) Intergenic
No off target data available for this crispr