ID: 1041633170

View in Genome Browser
Species Human (GRCh38)
Location 8:60111048-60111070
Sequence AAGAAGCATAATTATAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041633170_1041633173 2 Left 1041633170 8:60111048-60111070 CCCGGCCTATAATTATGCTTCTT No data
Right 1041633173 8:60111073-60111095 AGATCATATTATTACCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041633170 Original CRISPR AAGAAGCATAATTATAGGCC GGG (reversed) Intergenic
No off target data available for this crispr