ID: 1041648489

View in Genome Browser
Species Human (GRCh38)
Location 8:60277885-60277907
Sequence AAGGGGAATCTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041648486_1041648489 -7 Left 1041648486 8:60277869-60277891 CCATGACAGAGAGGATAAGGGGA 0: 1
1: 0
2: 1
3: 16
4: 195
Right 1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041648489 Original CRISPR AAGGGGAATCTGAAGGAGGA AGG Intronic
No off target data available for this crispr