ID: 1041650983 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:60302649-60302671 |
Sequence | CTTATGTAAGCTATATCTTA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1041650983_1041650987 | 14 | Left | 1041650983 | 8:60302649-60302671 | CCATAAGATATAGCTTACATAAG | No data | ||
Right | 1041650987 | 8:60302686-60302708 | TATAACCTTTGTTAAGGAATTGG | No data | ||||
1041650983_1041650985 | 8 | Left | 1041650983 | 8:60302649-60302671 | CCATAAGATATAGCTTACATAAG | No data | ||
Right | 1041650985 | 8:60302680-60302702 | AACCTTTATAACCTTTGTTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1041650983 | Original CRISPR | CTTATGTAAGCTATATCTTA TGG (reversed) | Intergenic | ||