ID: 1041650984

View in Genome Browser
Species Human (GRCh38)
Location 8:60302672-60302694
Sequence AAGGTTATAAAGGTTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041650984_1041650990 25 Left 1041650984 8:60302672-60302694 CCTTTTAAAACCTTTATAACCTT No data
Right 1041650990 8:60302720-60302742 AGAAAACCTTGATACTCACAGGG No data
1041650984_1041650989 24 Left 1041650984 8:60302672-60302694 CCTTTTAAAACCTTTATAACCTT No data
Right 1041650989 8:60302719-60302741 AAGAAAACCTTGATACTCACAGG No data
1041650984_1041650991 26 Left 1041650984 8:60302672-60302694 CCTTTTAAAACCTTTATAACCTT No data
Right 1041650991 8:60302721-60302743 GAAAACCTTGATACTCACAGGGG No data
1041650984_1041650987 -9 Left 1041650984 8:60302672-60302694 CCTTTTAAAACCTTTATAACCTT No data
Right 1041650987 8:60302686-60302708 TATAACCTTTGTTAAGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041650984 Original CRISPR AAGGTTATAAAGGTTTTAAA AGG (reversed) Intergenic
No off target data available for this crispr