ID: 1041650986

View in Genome Browser
Species Human (GRCh38)
Location 8:60302682-60302704
Sequence TTCCTTAACAAAGGTTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041650986_1041650989 14 Left 1041650986 8:60302682-60302704 CCTTTATAACCTTTGTTAAGGAA No data
Right 1041650989 8:60302719-60302741 AAGAAAACCTTGATACTCACAGG No data
1041650986_1041650990 15 Left 1041650986 8:60302682-60302704 CCTTTATAACCTTTGTTAAGGAA No data
Right 1041650990 8:60302720-60302742 AGAAAACCTTGATACTCACAGGG No data
1041650986_1041650991 16 Left 1041650986 8:60302682-60302704 CCTTTATAACCTTTGTTAAGGAA No data
Right 1041650991 8:60302721-60302743 GAAAACCTTGATACTCACAGGGG No data
1041650986_1041650993 28 Left 1041650986 8:60302682-60302704 CCTTTATAACCTTTGTTAAGGAA No data
Right 1041650993 8:60302733-60302755 ACTCACAGGGGCCCATATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041650986 Original CRISPR TTCCTTAACAAAGGTTATAA AGG (reversed) Intergenic