ID: 1041650987

View in Genome Browser
Species Human (GRCh38)
Location 8:60302686-60302708
Sequence TATAACCTTTGTTAAGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041650983_1041650987 14 Left 1041650983 8:60302649-60302671 CCATAAGATATAGCTTACATAAG No data
Right 1041650987 8:60302686-60302708 TATAACCTTTGTTAAGGAATTGG No data
1041650984_1041650987 -9 Left 1041650984 8:60302672-60302694 CCTTTTAAAACCTTTATAACCTT No data
Right 1041650987 8:60302686-60302708 TATAACCTTTGTTAAGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041650987 Original CRISPR TATAACCTTTGTTAAGGAAT TGG Intergenic
No off target data available for this crispr