ID: 1041650988

View in Genome Browser
Species Human (GRCh38)
Location 8:60302691-60302713
Sequence ATTAACCAATTCCTTAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041650988_1041650990 6 Left 1041650988 8:60302691-60302713 CCTTTGTTAAGGAATTGGTTAAT No data
Right 1041650990 8:60302720-60302742 AGAAAACCTTGATACTCACAGGG No data
1041650988_1041650989 5 Left 1041650988 8:60302691-60302713 CCTTTGTTAAGGAATTGGTTAAT No data
Right 1041650989 8:60302719-60302741 AAGAAAACCTTGATACTCACAGG No data
1041650988_1041650991 7 Left 1041650988 8:60302691-60302713 CCTTTGTTAAGGAATTGGTTAAT No data
Right 1041650991 8:60302721-60302743 GAAAACCTTGATACTCACAGGGG No data
1041650988_1041650993 19 Left 1041650988 8:60302691-60302713 CCTTTGTTAAGGAATTGGTTAAT No data
Right 1041650993 8:60302733-60302755 ACTCACAGGGGCCCATATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041650988 Original CRISPR ATTAACCAATTCCTTAACAA AGG (reversed) Intergenic