ID: 1041650991

View in Genome Browser
Species Human (GRCh38)
Location 8:60302721-60302743
Sequence GAAAACCTTGATACTCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041650988_1041650991 7 Left 1041650988 8:60302691-60302713 CCTTTGTTAAGGAATTGGTTAAT No data
Right 1041650991 8:60302721-60302743 GAAAACCTTGATACTCACAGGGG No data
1041650986_1041650991 16 Left 1041650986 8:60302682-60302704 CCTTTATAACCTTTGTTAAGGAA No data
Right 1041650991 8:60302721-60302743 GAAAACCTTGATACTCACAGGGG No data
1041650984_1041650991 26 Left 1041650984 8:60302672-60302694 CCTTTTAAAACCTTTATAACCTT No data
Right 1041650991 8:60302721-60302743 GAAAACCTTGATACTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041650991 Original CRISPR GAAAACCTTGATACTCACAG GGG Intergenic