ID: 1041653288

View in Genome Browser
Species Human (GRCh38)
Location 8:60322492-60322514
Sequence TGGTGAGAGACCCTGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041653288_1041653293 -2 Left 1041653288 8:60322492-60322514 CCCTGGCTCAGGGTCTCTCACCA No data
Right 1041653293 8:60322513-60322535 CAAGGCTGTAGACAAAGTGTGGG No data
1041653288_1041653296 9 Left 1041653288 8:60322492-60322514 CCCTGGCTCAGGGTCTCTCACCA No data
Right 1041653296 8:60322524-60322546 ACAAAGTGTGGGCTTGGGCAAGG No data
1041653288_1041653295 4 Left 1041653288 8:60322492-60322514 CCCTGGCTCAGGGTCTCTCACCA No data
Right 1041653295 8:60322519-60322541 TGTAGACAAAGTGTGGGCTTGGG No data
1041653288_1041653294 3 Left 1041653288 8:60322492-60322514 CCCTGGCTCAGGGTCTCTCACCA No data
Right 1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG No data
1041653288_1041653292 -3 Left 1041653288 8:60322492-60322514 CCCTGGCTCAGGGTCTCTCACCA No data
Right 1041653292 8:60322512-60322534 CCAAGGCTGTAGACAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041653288 Original CRISPR TGGTGAGAGACCCTGAGCCA GGG (reversed) Intergenic
No off target data available for this crispr