ID: 1041653289

View in Genome Browser
Species Human (GRCh38)
Location 8:60322493-60322515
Sequence TTGGTGAGAGACCCTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041653289_1041653295 3 Left 1041653289 8:60322493-60322515 CCTGGCTCAGGGTCTCTCACCAA No data
Right 1041653295 8:60322519-60322541 TGTAGACAAAGTGTGGGCTTGGG No data
1041653289_1041653296 8 Left 1041653289 8:60322493-60322515 CCTGGCTCAGGGTCTCTCACCAA No data
Right 1041653296 8:60322524-60322546 ACAAAGTGTGGGCTTGGGCAAGG No data
1041653289_1041653294 2 Left 1041653289 8:60322493-60322515 CCTGGCTCAGGGTCTCTCACCAA No data
Right 1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG No data
1041653289_1041653293 -3 Left 1041653289 8:60322493-60322515 CCTGGCTCAGGGTCTCTCACCAA No data
Right 1041653293 8:60322513-60322535 CAAGGCTGTAGACAAAGTGTGGG No data
1041653289_1041653292 -4 Left 1041653289 8:60322493-60322515 CCTGGCTCAGGGTCTCTCACCAA No data
Right 1041653292 8:60322512-60322534 CCAAGGCTGTAGACAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041653289 Original CRISPR TTGGTGAGAGACCCTGAGCC AGG (reversed) Intergenic